Description :
From Genome Similarity Track
Location :
Scaffold_528:13616- 14969
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_528-fgenesh-gene-0.3Ribonuclease P 40kDa subunit isoform 3

Sequence
1353 bases(100 bases per row)
GTATCCATTCGCCGCACTAATGGTGAGTGGCGGCGGCAAGCGCGCCAAAGACCGTGGCCCCGCCAACGCCGGCGGCAGCGGCGCCTCGTCGTATCCGTCG
TCTCGTCTGCTCGTGTGGCACTCGAGCTTCGACCACGCGCGCTCGCGCCACGCGTCGCTCGTGCGCGGCCACGCGCTGGCGCAGCAGCTCGAGATCGTGC
TGCCGACGCGAGCGGCCAAAGACTTGGCGGCGTCGCTCCAGTGGGAGACGAGTTTCTTCTACGAGGTCACGGCGCCGCTCACACAGCTGCTGACGCCTCG
GTTCATCAGCGAGTACGTGGCGAATGGGGCTTTGTACATGGTCGCCAAGAACGTGGCCGTGGACAGCCAGAACACGGCCATGGTGCTGCCCTCGGGCGAG
CTGCTGGTGCTCGTGGACAATGAAACGTACGAGCAGCTCGGCCTCGTGGGCCACAAGTACGCGCAGCAGATCCCAGCGGACGCGCAGTGCGCGGCGCCGC
ACCGGTCATCCTCCGGCTCTCGGCGTGGGCAGCGCTACGTCATCTCCATCGACCTCAAGAGCCGCGCGTTCTCCAGTCCCGAGCCAAACGCCTACCGCGA
TCGCGTCGTGACGTGTCTCGCGACCAAGTTCCAGCCGCTCACGATGCTTCTGGCGTCCTACAACGACCGTGGCGCGCCGCGCACGATCCTCTTTGACGAC
GACACGACGGTCGAGCGAACGCGCGTCGAGATCAATGGCAACCACGAGCAGCTCCATGGGATCGCGGTCCCCGCCCTGCACCAGTTCTTCCCCGAAAAGA
CCCGACCGCCACACGAGAAGATGGACATGGCAATGCTGCGAGGGTCGCTAGAGGGCGTCTACGACTGGTTGGGTGCCGTCGCGTGCCGTCTCACGGAGCT
GCTTCAACGAAAGCCAGTGGAAGAATACGTCTCGACGTTCGACGCTGGACTCCCCGACGCCATGCCTATGGATCCTTCCGGCGATTTGTCAATCGTCACG
TGGCGCGGACTCCTGGGCGCTGAATTTACTCAACGTGTGCTCGACCGTACGCGCGACGCAGTTTTGAACGGCTCCATCCCGTGGGCGTCCGTCTCCGTGT
GGGGCTTTGCTGACGCGGTCGTCTCGTGGCGGCAAACTTACGAGTCCAAGCAGCCCACGCTGTCTCGCGCGCAACAGAAGAAGCTGCAAAAGCTCCACGA
GACACCAATGGCGGACGTGGAGAAAGAGACGGTGCACGTCAACCGCGAGCACGGGTTTCTGGTGAACGGAAACAACAACTATACATTCCTGCTGCTCCCG
CACCAGGAATATTTCGTGCTCCAGGAACTTGGTCCTCACGATGCCGCCATGTA