Description :
From Genome Similarity Track
Location :
contig_7:136093- 137546
Transcript NameFunction/comments
g2006.t1PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1453 bases(100 bases per row)
AGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCGTGCTGGACGGTATGTCCATTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGACTGGTCCAATGA
AGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTAAATTAATTTGT
GTTTCCCCTGCCGGTGTTATCGGCGTTCAATAGCAGCTTCTGTTGATCGACAGAAGCTGCTATTGCGTCCTGGACAAACCGAATTACGGCTTGTCGGCGC
TGGACAAAGTTCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAG
TGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATGGCTTGTATCAGCGTGCTT
ATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACG
TAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGC
TCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGT
AAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCAGGTCAACAAATAGG
CATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTT
GTCTTGCGGAAGACCAAAAACAAAGTCCATTGAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCT
TCACGCGCTGGCATACCTCGCAAGCACGACCGTACTTGCGTACCCATTTGTACTGGTGACTTCAGTAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTC
ACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCG
TCAACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCATGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTG
TGGAGAAGTACTCCAACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCC