Description :
From Genome Similarity Track
Location :
Scaffold_277:13608- 14671
Transcript NameFunction/comments
Phyci_73893Hypothetical protein
Phyci_255093Hypothetical protein

Sequence
1063 bases(100 bases per row)
AGGTCGGTGCGAGCGAGCTGGAAATCTGTGGGCGACTGCGAACAGATCCAGCTGACTTCGGCCGCACGAATAAAATTCTTGGTGGCTTAACGCCCTGGTT
CATGACATCAACTCGAGTTACGTCCAAAGCATCCACCTAAGCAAGGTTTTCAAATCAACGCAACAAAAGAAGGCTTCATAAGCTGGCAACCAGTGAAGCT
ATTTTTACAATCAAGGCCTTGAAGGTGGATACATAACCGCTCAGCAAGCGACCCCAAGTTTCAGACGAGCGCAAGATGTCAAAGCGCAGTGGTATGCCAA
CTCAAGCACCGCAGCCCTCGAAGCCGCCCGGTTGCAAGAGGAACGAGTTACCACGCTCGGCGAGACCCTCATCTCCAGCACAAGCGCCGAGTTCTCGTCG
CAGTATCAAAGCGATTCCCAGCCAAAACTCGATTCAGAGTAATGATGACAACAACAGTTCTTCCAACAGGTAGACCTTCAACCTTCAACTTGAGTTTTCT
CTTTTGAGTTTTCTCAGGCTTCATCAGTATCCACTCACGAAGTGTTGCAATGATATTAAGTCCACACACTTCTGCACGAGACAGTGAACCAGCCACAGAC
GACGAAGCAAACATCACTTCTGCCTTCGGGGGTGTAAATGAATCAACGGACTATGGAATTTCTTTCCAGTTCGACATTGCACAGCGTCAAGCTGTCGCGA
TGCTGAACAACATCACCAAAAAGAGCGAGCGAAATCACCAAAGGTACGCTAAAGTATGTATTCCGTGAGTGATATATTGGCCGTGTCTTACGGCTTCGGT
TATTTATTTGGCCAGGTACGACGAATTTCGCGATAACATTTCGGTAAAAGACAAGCGCATCGATGAGCTTCACGCATCGTAAGTGCTCATCCTGTTGGGT
TACGGCACTTATATACCGGGTTCTTGACAACAATTCTACTCTCAGATTCGAAGATTTGGCCTGCCAAACAGCAGGCTTAGAAAGACTTTGCAACAGCGAT
GTCGATGCTGCTTCGCTAGAGAAACTTTTCATGGCCATTCCTTTACAACAACGTAAACTCTAC