Description :
From Genome Similarity Track
Location :
Scaffold_285:136- 2596
Sequence
2460 bases(100 bases per row)
GCCCTGGGTATCTTCATGTTTATATACTGCGTGTATTTGCGATGTGCAGCCACTTCTGCTCTCTATGCGTTGTGTGATAATTGCGTTGAGGTTAATATTG
CAGCTCCAGAGAAAGGAGGTTAAGCTTTGTGTTCGGCGTAGCACTCAAAATACGTGCTCGGTTTGTAACGAGGTTAACTTTGCTGTTTCATTTGGAGGTT
AAGCTTAGTGTTCAATACTACCAATGCATTTCTCCTTCGAACGAATATTAAGAACTTAATATACCCTTTATTTGCTCCTTATTCTTCACCTCAACTTGTG
CTTTCGCGTCATTTAGCGTGTTGTCTTCTACAGCTTCGTCTTCGATGAAGATCTATCGTCGACACTCATTCTGGAAGGCTCACGAGGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACGTCGACT
CTCAATACACACAGTAATACGTCTTCCGGTTCTGACATTTCCATTTAGCAGCTTGCGGACGTAGAGCTGCTTCTCTTCTTCTGGCTTATCGTCGGTGCTG
CTCTCGTCTTTGGGTTCTTTTTCGCTGGCGGGACTAGGAGGGGCAAGCCACTCGAGGAGGTCGTTGAGTTTGTATCGCCGCTTGCTTCGTTTCTCCAGCA
AGGCGATCAGAACATCAATTGTTCGGGAAGCAAGGCTACGGAAGCAACGGTTGAAATTACGGTAAGGCGCAGGAAGGGATGGCTCCATCACTAACTCGAA
CCGTGTAGCGCTTGGATACAGTTGCGCACACCGTCTTGAACTCCTCCCCCAAACGGATGGCCTTCTTTACTGGCTTTATCGAGGACACGGTTTACGGGTA
TGTTCTGGTCGGCGATGAAGGGAAAATGAGAGAGTGTACTGTGAGAACAAGAGGATTAAGAACAAGCACTGATTGGAGCGACACGTAGATATAATGGCAA
GTAATTAGACGGTTTGCAGTCCCAAATGTTGGTCGTTCGGAGAGCCGCATGTCGAGCTTCTGTTTAACCTGAATTAACTGCTCAATCGAGGATACTTGGT
GAAGATGCATGGGCTGTTGAGTGTAATTGTTTGAGGTTCTTTATGGAGCGGCGCTGTCATGGCGTTTGCGCTTGTGCAGCCAGCAAGGGTACGATGATCA
TGATATCAAATCGTTATCGTAGAAGGCTTTGTCGCGTGTATACGCCCCAATGTGTTAGATTGCTGGACCGTTCCCAACAAGATCCTTCAACAGAGGGTAC
GGCTTCTGCAGGTACGCCATAAAAGTGCCGTGTACTCGTTCGTTCACGTTGTGATGTGGCGTCTCCAGACCGGATGAAGAGCTGAATAGAGCCGACACGA
CGAAATGAATTTTCGTCAGCGTACCGGAGTCAAATAAATCTAAGAAATGAATCGAAACCGGTAGTTCAGGGTCTCGACTGCTCCAGACGCGTGCGACTAC
ATGATCTTACCAAGGGTATTGAACACAGACGCGACGGTTTGGTTTGTTGTTGTCATGCTCGTTTTCCCCCGGTCGAAGATCCAATGAGCACACACCCTAT
TTCCGTTGGTATGCTGTGCACCTTCGCGTCCGACCACAAACGCTCGGTCTCTCCAGCCGTTTGAGCGACTCGATCCAGGACACGGTTGACTTAAGTATGA
AAACTAGGCACATCACCAGTTTTTTTGGTAGTCTGACGGAGTAACAGCAGTCAAATACAGATAGACGATCATTTGCTTGAGGACCTTCTACGTGCACGCG
GGAGCTTTGTTAACAAATGCTCCTGACCCCCCTACAGGCAATAGCGCTCAAGAACTTGTCCTTTCATGAGCAGAGGCTTCTCGATAGTGGCCCGATGCTG
AGGGAACTTCTCGAGCAACTGATTCTTCGCCTGTCGGTACTACTGTATGACTGAGTGTCGAGCCAATAGCTGCCTTTGCAGCCTTCCTGAAGGCGAGATG
CAATCCAAATTTGCCGACAACAGCCGCTAAGATGCGCCACGAGTTGTCGCGCCACATGCATGCTTCTAGGTACCCCCAGGTGACGCCTTCATCTCTTCGA
CAGACTTCCGGAACGACCGCGTTGCTGACTCCCGAGATCGGTTGGTGTTAGCCGGTCTGAGATCTTTCAAACTCATTTTGGGTCAGAGGCGTCGGGGCTT
GAGTGTTATTTGTAAAATATGCGAATGTCTTATGATCGGTAAGGGTATTTCCATAATTTCGCTGGTCTCTCCGACTTGATATGTCGGAGATGTGGTTATG
TAGCCATCTTATACCATTGAGGCCACCGATTGGCTGAAAAAGATGCCTTTACGTATTGAAATCGCCAAAATGACCACTCAGCTCAGAACTTTCGTTTTAT
TGGACAATATTAGCCATAGTTAATAAAAGTTTGGTGGGATTTTTGAATTAATTCATCCAT