Description :
From Genome Similarity Track
Location :
Scaffold_1387:136- 1957
Sequence
1821 bases(100 bases per row)
TGCGGCCTCCTCCTCGTCCCCACCGCCCCCCTCCTCTTCACGACCCTCTTGTCCTTCCGCCCGCTTTGGGGGGGGGGACCTCAGCTGGATACCGCGGCCG
TGGCGCGGCTGTGGGCGCTCGCTTCCATTGCGCCAAAGTTGGTGCCAAATAGAGAAGCAAGTCTGGTTGTTATTGAGGTAATGTGCTTGGCGCACCTTGT
CACACAAGTAGACACTGCATTATACGTGTTAGATAGCAGTAGTAAGAAACATAGAGCATAGCAACGTACCGTTTTGAGCCTTTACTGCAGCCAGGACAGT
AGAATCGCGTCACCTGCCGCTGTGTACTGCTTGTTTTCCGTATAGTACAGACCTTGCACCGCCGTTGACGTCGCTTTCGAATTCCATTCACCTCCACCCA
TTCGTCGTCCATCTTTAGTTGGTGGGTGGACGGTGGAGCGTCGCCATGCAGTGGTGTAACTGGTCTAGGTGAGTACATCTTTGGACACATACAGTACTAG
TTAGCAATGAGAACAACAAGCAGAATGAGCACCTTACTTACCGTGTTTGCAAATTCGGCTGACCCCACTTGTGGTAGCTGGGTTTGCAACTGAGCGATGA
AACCGGCTAGTTTGAATGGTCCCCACAGAATAGACGTTCCTCTCAAGAAGTTGTAGCGAGCTTTGTATCTACTAGATTCGACAAATCAGACCCTTCAACG
ATGCGCCAATTGTCCATGATGTCATTCCAGCGTTCGGCCTCCTTCTTACTTCGTGGAGGTCGCTGCCCTCAGCGACGGTTAGTTGTAAGAGCTGCGCCAA
CTGAAGGTGTAGAACTCGGTGAATCGCCAGTTGGAGATGCATCTAGTGACAGTTCATCCCTCGGACCTCAGCTGGATACCGCGGCCGTGGCGCGGCTGTG
GGCGCTCGCTTCCATTGCGCCAAAGTTGGTGCCAAATAGAGAAGCAAGTCTGGTTGTTATTGAGGTAATGTGCTTGGCGCACCTTGTCACACAAGTAGAC
ACTGCATTATACGTGTTAGATAGCAGTAGTAAGAAACATAGAGCATAGCAACGTACCGTTTTGAGCCTTTACTGCAGCCAGGACAGTAGAATCGCGTCAC
CTGCCGCTGTGTACTGCTTGTTTTCCGTATAGTACAGACCTTGCACCGCCGTTGACGTCGCTTTCGAATTCCATCACCTCCACCCATTTTGTCGTCCATC
TTTAGCTGGTGGGTGGACGGTGGAGCGTCGCCATGCAGTGGTGTAACTAGTCTAGGTGAGTACATCTTTGGACACATACGGTAATAGTTAGCAAAGAGAA
TAACAAGCAGAATAAGCACCTTACTTACCGTGTTTGCAAATTCGACTGACCCCACTTGTAGTAGCTGGGCTTGCAACTGAGCGATGAAACCGGTTAGTTT
GAATGGTCCCCACAGAATAGATGTTCCTCTCAAGAAGTTGTAGCGAGCTTTGTATCTATTATATTAGATAAATAGACCCTTCTACGATGCGCCAATTGTC
AATGATGCCCTTCCAGCGTTCGGCCTCCTCCTTACTTCGTGGAGGTCGCTGTCCCCCGCGACGGTTTGTTGTAGAAGCTGCGCCAACTGCAGGTGTAGAA
CTCGGTGAATCGCCAGCTGGAGACGCATCTAGTGACAGTTCATCACTCGTCTCCGTGTTGCTCTCGCTTGGAATCTCAGCATCCACAACATCTTCAAGAT
TGTCCATGTCCTCGTACCATTCTGCTGACCCAGTGTCTGAATCATCGTAATCCGAATCCAATGCGCCACCATCATAGATGTCATCATCGTGACGGGAATC
TTGACGGGAATAGAGAGGAGG