Description :
From Genome Similarity Track
Location :
Scaffold_53:135999- 141282
Transcript NameFunction/comments
Phyra_80836NAD(+)-dependent deacetylase

Sequence
5283 bases(100 bases per row)
ATGATGCTACGTCAAACGTATCTGCCTAATTGTGGCTCGTGGACATTTACTTGTCCAAACTGTCCATTTCTCGACGCTTGATTTTCTTTCTCAATCGCCT
TCAGCTCTCGCTGGCGCCGATTCTGTGCTCGGTGTGACTGACGCTTGAATTGGTCGAAGGATGGAAGGAGTACAGCAATCAACGGAGAGAGCTGGAACGG
GGAGATAATTAGCTGCTCAATGGCATCGGCAGTCGATATATGCCGACTTGGAATTGACTTTGCGCAGCACATCCACTCTTGGGTCGTTGATCTCAAGCTT
GGTATTCCACACGGGCTGGACATTCTTGCACAATGACGGTCTTGAAGGACTGGGATTGCGTGTTCGAAAGGCCAGTAAACACGATATTCTCCATTGGAGA
ATTCGCCACGAGCGTCTTCCAGCCAGCAGAGACACGGCGAGCTGAATAGTGGCGCCGTGGCTTGAACCGATGTGGACTTGTACCAATTGGGTCTCATTGG
TACTGGTATGATCGCTTGAGCTCAAGGAGTAGGGAGATGAATTGGATCAACGGCGGTCTCGCCCTGATCTTTCGCTTGTTGTTTGACTATTGCGAGGCAG
TTTAGTGAATGAACTCGGCCTCTCGCCAAAATGTATGTTCAGCAGGCCTTCAGCACACTTGCCTACAACTATAGAACGTTGTGCAACATGTGGGTGAGCT
TGGGAACGTCGATCGTTGTCGGCTGCGCGTCTTCTCTGCGCTCATTCAAGCTGAAACTGCGCTGTGAGCTCAGTGTCTTTTAGGAGCGAGAACATGGAGT
TCCCTGAGGATCGACAGCCTAAACATCGTTAACATGAACGTGTGAAAGGCCTTTGCGCTATCTATCATCGTGGCGTGCTGTATAAGATGCCTAATATCAT
GCCAAGTAAGAGAAGCTATCGATACTCTATAAGCACTGCGAGAACCGATGTCTGCCGCTCTTGTGCTTGAATTTCCTCTTGGGGTAGCAATCTCCACACA
GATCGTAGTCGAAGCAGTCACTGCAAGCAAATTCCCAAGTTAAATTTCGTCTCAAGGAAAACCTCTGAACGTCGCAAGACTTACTTGCAACGGTAGTGGA
CAGTTTTGACACCAGGACCAGGTTCCGCGTCCGGATCAATGCGCTCTTCGCATCGATTGCTGTATTGCCACATCAGTGCATTCATGTTAGAAGAGTAAAT
ACACTCCGCCATGAAAGTTAATGTTGAACGTACCACACGATCTCGTCTCCGAGCTCTTCTTCTTCCTCCTCCTCCTCCTCGTCCTCTTCTTCGTCATCGT
CACCATTCATACCAGCAGCAAGTTTGTTTTTACACTGGCATTCGCCAAAGCAGTACACACGCTTGCCAGTAGCATCCTGATGAGACATTATTTCACTGCG
GTGAATGAGAGGCTTCTTCTTGGCAGCCTTGATTGCGTTTGGGTCTAAGGCCCAACCAGCTTGTTTGCAGACATAGCGGATGATATCGTCGCAATCGCCC
AAAAGTGACATGTCGAACTCTTCTTCATCAGTGGCCCCGTTGTCGTTACCTCTATTTGTACTAACTCGGCTCATAGTTCCGCCCGTCGAAAGCCTTTTCG
ATTTCAGTTTCTTTTTCTTGAGCACAGTCTTGTTGATCACCACTTGAGGAATGTGTGAGGGCAAATATCCTGGGATCTCCATCACGGGCGCAACCTTAAG
CGACGTGCCCATAACAATAAGTAAATCTGCCTGCAAGCGGTCCTTCGTAATTGTCGTGCTCACTTTGTCATCCAAAATCTCCCCGAAGAACGTGATCTCC
GGCTTCAGCACACCGCGGCAGTTTGGTTCTGAGCACGAAGGGATGATTCCCGCCTGAATGACTGGCATTAAAGTGTTCGTTGGCACGCGCTTCTTGCACC
GCATGCATGCCGAATACGCAAAGCTGCCGTGGCAAGGGATGCACCTCGTCACTCCAGCCGCTTCCTCCAAGCCATCAATATTTTGCGTATACACACGCAA
CAGCTTCTTCTTGTCCTGTAGTAGCCTCAAAAACCAATGCGTCGGTGACGGCTTGGGCGAATTGGCAAAGGCGTTGCGCACCACTTCGAAAAATGGTGCC
GGGTCCTCACGGAAGTAGTCAATTTGGAACAAGCACTCGGGTTCCGGCAGCACCACGTCCATGTTGCGAGCCATAGCGTAGATTCCGTCTTTCGAGCGGA
AGTCCGGAATACCGCACGACACACTGATCCCTGCTCCTGCAATGACCACGACCTTCTTGGCCTTCTTGAGCACCTTGACAAAGTCGGCAATGGAGTCCAA
TGTCTTGCGAGGCAGCGAACTCAACGAGTCCACCTTGGCTTCCTGGAGACACTCGTAGCAACTTGTATTGCCCAGAATGGACGCCGACTGGAAAGGTTTG
CCGCATGCTGCATGGTACCTGCATCCACATGCCACCCCAAGCCACAAAATACATTTTACATATAGTAGCAAAATTTAGTAAACTATGGTACCAAATTCTA
ATAAAATAGTAAAAGAATGGGTGGCACGCGTACAGTCGGGAACAGCTGTCACACTGGAGCATGGTGTTTCGGTAGGTTCTGGGGGGTCGGTGGCAAATAA
AGCACTCGGTCGATCCTTTGCGACGCTTTTTCTTGTTGGTGCCGTAACTTTCGTCCGCCGAGTCGTCCTCCTCGGTCGAGTACTCTGGGATTTGCTGGCC
CGAGGACAGAACGGCGTAGTCCACGTCCGTCCGCTTGGCCTTCCGGCTGGGCCGCTCCGATAGCGCCATCATTATCCGAAAAGCTTAAAGTGGCTCGATG
GAGGCGAATCTGGGAGTGAGGCCCGTACAGAGGGGGGTACGCCGTTTTTATTGTTAGGTTTTTCTTAGTTTTCCGGGCTGGAGAGCCGTCGTAAGTACGA
TTACGATGATCCTGGGTAAAAGCAAGTGTTTGCAGACCACCGATTGGGATGGGGAAGGAACTGAAATGCGACGAGAAAGAGTGTTGCACGATAAATAGAC
ACGAGCGAGCTGGCTGACGTGGGCTTCTTGGCGTGGCCAGGATGGCGAACGGAGTGTTGGTCTGGTTTCAATTGTTCGGATTGGGAAATAAATATATTCT
CGAGTCGTGAGCTCTAGGTGGGCCTTTGAAGGTGTTGCCGCCGGACCATTGCCACGTGGAGATTTGTCGTGATCGGAAAGCACAGGAATTTTAAGTATGA
TGCATCTCGATCGTTACACGGCGAGGAGGCTCAGACGCCGCCCCGCCAGTCGAGGCTACAAATGTAGGAGCAACGCAGATTAGGATGGAAACGAAGTGCC
AATATGTACGAGGAGGATATGCTGGCGGACTTATACTGAGTGGGTTGAGGCTCGACGATGGGATTCCCTACCTTGTGGGTCATGTGCTGGGTGCTCGACG
CAGTTGTGGTATAGTATGTGGTACCCAAAGTCAACATTCCCATCGAATACGGATGGTGATGCGCGAAGAATCCGTCAAGGTGCGTGCGTGTGTAAGCCGG
AGAGGGCAGGTTGGGTAGCTGGCATTGACAGGATCGCGCCAGCGTCATTACGCGACGGATGATTTGAGGGCGGATGGTCTGCTGGAAAACGATCGGTCAA
CCAACCAAACATATTTTGTATGGGCATTTTGCAAGCCCCTTTTCGGGTTTCCAGCGACTGCAAGACTGCGCACGTGCTGGGCGGCACTCGCGCTGCAGAG
ATGACGGCCGGCGCCAACTGCAACGCAAGCGCAATCGTTTTTCGGTTTTGTTGAGCCATAGTAAAGATAGTATTATTTTCGGTAGATAAAGTTCCAAGTT
TTGATTACATACAAAACGAAAGTGCAAGTCAGAGCCATGACACATCGCTTGATGCAGGGTATCGCTTTAGTGAGTTTAGCGCTCCGCAAATTGAACGACG
GACTCACTGGGAGTGGATGTCGTGCACTGGCTTGTTTTTCAACTGTACCTCGAGACTGGAGCACTAAGCTACTAATAGTACATGCTCGGCCATGAACTTC
GACATGGTAAGCCCCACGATAAAATCATCGAACCACGCCGGAAGGTTTGCGCTACGCACTGAAACGCCCAGTGTTCGAGAACCATCCGATCACAAGCAGA
GATCATGCGTGGTGTGTCGCAAGTGGATACGCGTCAACAGGTTGCAGTGATCTTTTTGGGAGTGACAACAATTTCCCTTTTTGAAATGACAACCTTTGGG
ATGAGCGATGCTAGCTGGGAGGCTCCATCAGTGCTAGCGATGCAGAAAATACTAAGCTTGGCTCCTTCTGCTATATGCATCTGAACGTTATTCAGTCGCA
CGTGGTAGTACGTTTCCTCGTGCACAACACAAGGTGCTGTAGGTAGACCGGAAGACTATGACGTAGAGAAGACGTACTCTTTCATAATGTTAATCCTACA
AAGTGATCCGAAGTAGCTCTAAAACGTCAGTGAATGCCAAAGGGCTTAAGCGTTTGAAAAAGCAACAACGTTAGCGCAGTTATAGTCTATCACTGATAGA
TGCAAGTATTTGGGGAAGGAGCTTGCCGTGGGGCACGAGTCGCGGAACACGCTCACGGTTTGTTTGCTTTTCATGAAGATATCGTTCGTCCACCGCCTGA
GCTGCTTCCGGGCCTTCCTCATCAAGCTCTGGAAATATTCAGTGTATGACGGCTAAGTTTGCAAAGCGGCGACTACCATTGATGGTGCGTTGGATTCCTA
TGACAGTGAATCCGAACTGTATTATGATAGCGATGAGAAGAGCTTCATTCGGTTGGAGTTTTCCACCTCATCCTGCAGGAGCGCATTGGAATGGTTGCAG
TGAGTTAGTCACGCGGCAGGGCGATGTTTCCAATGTCGGCCATCGTAGCGTTAAGCTTTACCGTATACACAAGCTCACCACATGACCCCACACTGTGTTA
ATAGTAGCATCGACCTACTGCGTCCGCTCTGTGATGGAGCCCATGCAATTGACTACACTCGGAATTCTCAATCCGCTCTTGGATTTCTTTGCGTTAGGCG
AAACTAAATGCCATTAAAATGTATCTCACTTCGAATTCTTAGCATGATGGTGGCAACACTAGTACCAACGCATTCGCTCACTACGGCCGGTCAGTTTTAG
CCACAGAAGTTTTCGTAGCGAGCTGCAAATATGCACGCACACACTTCTTTGTATGGGGCGCTCATCAAGTCGGCGTTGCAGCTCGCTGTCGAACGGCGCA
CGCCACGCCCACTGTAATATATCGTTAGTGACGTTGCTAAAGTTGCTCAAAAAAGTGATGTAGTGGTGTCGTGAAGCCAACGG