Description :
From Genome Similarity Track
Location :
scaffold_48:13599- 16333
Transcript NameFunction/comments
Plaha_PHALS_02249Karyopherin (importin) beta 3
Plaha_PHALS_02250regulator of g protein signaling

Sequence
2734 bases(100 bases per row)
TACTGTACTGGCTCATTACCTCGAAGATTTTAACAAGCCACGTCTTCAGGCCCATGCTGCAACATCCTTACGCCAATTCATTGACATGTGTCCATCTGAA
CTTCTGACTCCGTACCTTGATAAAATATTACATCAACTTTTTGCTTTACTACAAAACGGGCAATTGTTAGCCCCGACGGCCAATCAAGTATCTACTCAGG
CATTCATTGCCGCGCGCATAGTCCAGGAACAGGCAATTACAGCAATCTCATCCGTGGCCACAGTAGCTGGTGCGTCGTTTGCTACTTATTATGCTGCTGT
GTTGCCTCCGCTGCAGCAGATATTGCGCACCTGTCTGCATGAGTGTGTGACGGCGGCGGCTGCATCGCAAGGCTTGCTCAAGTCACAATCAAACGCGCCC
AGCTCATTTACGCTAGGTGGAATTACGCTTGAATGTTTGAGTCTAATTGGCCAGGCCGTAGGCAAGCAAGTGTTTTCTCGCGATGCTGCTGCGATTCTTA
AAATGATGGCGGAAATGCAGGCCACGCCATTTATTGTCGGCAACGAGTTAATTCGAACGTATCTGCTTCAAGCATGGGCTCGCTGCTGCACATGCCTTCG
TCACGATTTTGCTCCGTATCTACCCCTTGTCATGCCGACGCTGCTCGAGGCTGCCATGCAACAGGCTGAATTTGAAGTGGATCCGTCGACGCTGTCTAGT
GATGACGAGGATGACGCCTCTACCGATAGTGAAGACATTCAGCTTGCACAGGTGAATGATAAGTGTCTGAGTATCCGTACATCTATATTGGAGGAAAAAG
CTACAGCTTGCCAACTTTTAGCTGGTATGGTGATAGATCTGGAGGATGCGTTCTTTCCGTATGCCGAACAGGTTACACAAGTATTGGCGCCGCTGTTGAC
CGAGTCTGTACACTCAGATATCCGAGCCTCTGCAATTCGTGCAATGCCGGCACTTGTAAAATGTGTCGCGATCTCAACTGCTGCCGCGCCTGGTCCATCG
GAAAACAGTCAAGCTACAATCAAGCAAATGGTGGATTTCGCTCTCGGTCGTCTCGTCAATGCGCTGACATCTGAGCCGGATGTGGAATTAGTCGTGAGTA
TTATGCAGAGTATGATTAATTGTCTCAATGAAGCGTGCCAACCGCACCCAAAGCTGAAGCTTAATGAAGCACAGCTACGTGAGCTAGTACTTGGATTGCT
AGTGGTTTTAGGTGATAGCTTTCAACGTCGCGCATTGCGGAGAAGTGGCGCTGGCACCGATGTCATGGAGGCTGACGAGGAcgaagacgaagatgatGCT
GCGTCGCAGTCAACTGAGACTCAAGCGACTGAGACTGAGCTACATTTTGTGTTGGCCGAATGCATCGGAGTACTCGCCAAGACTCATGGTGCTGACTTCT
TCCCTGTATTTATGACGCTGTTGTGGGACAAAGTAACCGCTCTAGCGGCTCCTGGGTGTTTGATAGAAGACCGACAGCTTGCGCTCTTTGTCGTGGATGA
TGTTTTAGAGCACTGTGGTGACGCTGCTTTGCATCGTCTCGATATCTTTCTGCCTATTTTTATGAGTGCTTTGCGTGAGGTCCATGAGCCTGGTTTAATA
CAGGCCGCAGCGTTTGGTGTCGGCGTATGTGCGTCTCAAGGTGGGGATGCGTTCGCGCCACACGCCAAGCAGTGTCTTCAATTACTTCACAACGTCGTGA
CACAGCCTCATGCCTACAATTCCGAGCACCGAAATGCAACTGACAATGCTGTGGCTGCACTTGGCAAACTGTGCGAATTTCAGTCAGCTGTCGTGGATGC
AGCTacgctatttccgcagtggTTAAGTCTACTTCCCTTACGTGGAGACTTAGAAGAATCGCTTGCTGTCTTGCGTCGTCTCTGTGGCTACATCGATGAT
CGACATCCACTTGTACTAGGAGCACCAGACTATCAGCATTTAGGTAAAGTAGTTGCTGTGCTGGCTGCTGTGACTGACGCAAAGTTTTTACGCAAAATGG
GCAAAAGTGTCGGTGAAAAAGAGGTGTTGGCCCTACGTCAGCAACTTGCATCAAGTCTTAAAAGTCTTCGCGCATCAGTGCcagagatgatgatgagttA
TACATGGAATTCACTCTCAAGTTCGCAGCAATCGGCACTCCAAGAGCTCTTTGCATATGCGGAGTAACATATTACAAGGATGACTTTACTGGTTTGGAAT
GGGGCAATTGTAATATTCACACATTGAGCAAGACGAGTATAATTTAAACTTTACAGTGTGTACCATGATATCAAAGTTATGACGCGAGCAATAACATTGT
ACGTTATTCGTTTTAATGTCTAGACCATGAGGCGTGCCACTACTACTATAACTAAGACCTGGTGCAGCAATCATGCGCCCTTGTCAAGTGTGGTCTCACG
TGACATTCCACGGGCTTCTTGAACAAGATGGAAACGATGGCGAAGAAATGCCATTTCTAATTCTCCTCGAAGCATTTCACCTGGATAATCCTCGTGAACA
ATAGCCCACGCCCCAACTAAAGCCATAAAGATACGAGAATCCAAAAAGTCTGGAACTACAACGCTGCGCATGTGGTCGTAACATTCATTTTCAGCCTCAT
CGAACGTTGTACGACACGCTACGTCCAGCTGAGCCTCCACACGTTGGCATAGAGTAACAGCAAGTGGAATCTGAGTGCGTGGATTCGATGGATTCAAATA
TTTGTCATAAATCTTTCTGGCTGAACGCAGAACA