Description :
From Genome Similarity Track
Location :
Scaffold_216:13592- 16807
Transcript NameFunction/comments
Phypl_g5416hypothetical protein

Sequence
3215 bases(100 bases per row)
GGTTCAAGACACACTGGGATGTTGTGCAACACAGCGACCTCCACGCTGTCTTCACCCGCGACCGCCTCCGGGTTCAGGCCCCCGTTCTCTGACCCTGAAG
CGACGGTGTTCACCCTTGCCGTCCCAGCTCTCCGGAAATCACGGTTAGCTCGAGGTGCTTCTCCCGACGCCGTCAGCGTTCTCCGGTACCATTCCAGCCA
ATATTCAGGTGTAGCCAACTCTCCAGGGGACGACGCCTTCGTTCGTTTCAAAGTCTCCCCAGGAATCCGCAGGATAGCACTAGCTTCAGCCAGCGACAGT
TCTCTACGCCGGTCTATAATCGtgttcatcttcttctgccgctCTACCTCGTCCAGAGGGAATAATCGCTCTTCCAACTCCTTCTCGTAttcttccagct
cggagTCCGCCAAATTCCATCGCCCTTCTTCGAGAGCGACCAGCTCATCCATTGAGAAGACTCGTTTGTCCCCACCCGCACGGCCAGCGCAGGGCAGGGA
CTCACACGAGCCAGCTTCCTTTACTATCGCTTTCTTGTCGGACCTTTCGACAGGGTCGTCTATCAAGTCGTCCCGAGAACTCGCCCCGACACCCCTCACC
GGCATCATTTCCTCGGAGACGCTGCCTTCAAGACCCTCGACCCCTTGATGTCGCAGCGTTCTCCTTCCTCCCTCCCTCTCCggcgtcagcgtctccatAG
AACCCTCTCTCGGTGCTTCCGTTACGGCACACACGAACGCCTCTTCaccatcatcttcttccatAATCGAGGCCGCCTTCACACTCCGCACCTTCTCGCC
TTCCACGTTCCAcgctccttgtcctccttcttcaaTCGGCTTGCCCCGCGGACCCTTGAGGTCGCATCCCCCGTCGTAACTGCACCGACAGGAGATCCGT
AGTTCCATGACCCTCCATTCCCCTGTGGGAACAGGTTGCCATTCTGAGCCGGAACCGCATTCGTCGGTTGCCCCCAATTTCCTCCAGGCGGTGGATACCA
CGTCGCTGGTTGAGGTGGCACTGCCACGCTTGACAGGCTACCCGGCGGCAGAGTAGCGGTGTAATTCGGCGCTACGCCCGAAGGTGCCCCGGAGCTGACG
GGCACGCTCGTAAGTCTGCTGCCAGAACGGACTTCCTCAGAGCCGTAAGCCATTCCGGTCCCAGCGAACGCCGTCGTTCCGCTGGGCCCTGTCGTATTCG
GAGCTCCCTGTACCGGCTGAGTAGAGGCCGACGCGGCTTGTGTCGCCGGCGAGGGCCTCACTCCGAACCCTGTGTAGCCGTACCCCGACGACGGGCTAGG
TGACGCCGGCCCAAGTACGGTGGACGGGGTCTGTCCGAGCCTCTCGAGGTAGCGTTGCATCAGCGCATCACTACCAGGCTCCACGTAAACAGGGATGGTC
CCGCTAGGACTCAGCACCGGACGGGACCCGATCGTCGCACTGGAGTCCGCATTAGTCATCGCCACAGGCTACGGAGCTCCGGTCCCGCTCAGTAGCCCTT
CCAGCTGTTGTCTTAACGACGTCACTTACTCCACTAACCTCGGGCTTGTCGCGGGTGCGGGCCTCGCTGCCCCGCTCGGCTCTTGACCCCTTTCAGCCGC
CCGCCTAGCCCAGTAGTTACTCGGCCCCTCCATAGTCCCGAAGAGTTGGTCCCGAAACTCAGCCACTTGTTCTTCAAAAGTCGGCGGGCGGTACGCCGCG
GCTTCTTGAACACTCTCTCCTCCGAGCAGGCCCGTAGCCTCAGAGGACCCTCCAAGCGTTCCCGGAACGCCTCGGGTCGCTGAAGGCACCGCTTGTTGCC
CGCCCGTCGTCACCCCAATAGACGGTTCAGCCATACTCGCTATTCCGATCGGAACGGCGGGATCACTCGGCTGGATAGAACTCCCCACCGCCCCCGTact
tctgcttcttcctgATAGCAATCGCCGACTCAGCAGCTCTTGCATCGCCTCACGTCCCGCCGCCGTAGTCATCTGTGGCACTGGACTGCTCTCTTCACCT
CCTCTCAACGGTGGCAGCGAAGCCCTCGACTGGCTGCCCCCCGTGGTCTCTCCTTGATCTTTACGCCGTTCCGTCTCGAAACGGGGTCCTCtttcttcct
gctcttcttgttcCTGCCCTGCGTAGAAGGCTCCCGACATCGTAGCGTCGACTCCTGAGCCCCCACGGTTATCTCCTGCTTTCTTGCCCCCTTGCCGTAA
TCCTGTGTTTGTCGACATCGCTCGAACTGACCCGCGATGCCCTTGTTCCTCTTTACCTACTAAGTACTCCAGTATCCAAACTGTAACTCgcgacagcacc
aacagcCTCTGAGACCGCTACCGAAAcccacgacggcgtgcaTTATACTTCGTGTCCACGTATTCAGGCAGCCTGGAACGCCTCCTAGCGTTGCTGCGGG
CGCGAACAGTCGCGCCTGACGAAGTATCTCCTATCACGACCGTTCCCAATTACGAAAACGACACCCAGATGCTCCCAGCGTCACCTCTTATTCCAGCTCC
GATCCCTGAGCCCTCAATCCTGAACGCGAAATCACCCCACGCGATGATGCTaccctgcttctccaccaactTGTCCCGAGGTGGGGATGAACCTGTGGGG
TTCAGACCCTCGAGACTAGTAccccgccagctccaggcgTGAAGCGAGCTCGTGTAGTGGCCAAGCGGCTCGAAGAATGGACGAAGTAGTGTtcccaagt
tgaagtgttGAATAAAGTGTTCCTTAGTGTTAGCGTTCCTTCTGTGTCCTGTGCGTTCCAAGAGAAAAGGAAAAGTGAGAGCACGACTAGTACGGGCGGC
GCGCGCCCTCCAGACCTCTCATGAGCACGACACCCACCTGAttcgcacagcagcttccCCTCAGTCGTGCCTTCCGTCCTTGAACGTGACAACCCTCCCG
GGTAGCCCGTCATTCTTGCAGCCACGCGCGCATGTCTTccgtccttcttcgccttcgactGGTTTCTCGAAATGATGTCGCTAGGTGAAGAGGCGCCGGC
CGGCCTCCGGTGTCCGACGTCCTACATCCGGCAACTCACGCACGCCACAAGCGCGTTCGAAAACACTGCAGATCCCGATCCGGGACACGATGCGCGCTTT
CTATTGGTGCAAACCGTTTGCTTTGGGAAGGATTATTGGTCGAAATACGCCAAAAAGTCTGGGTGGCAGTATAATTTCCGCTCGCTCTGTAGCGATTACT
CGCGAATGGCACATT