Description :
From Genome Similarity Track
Location :
Scaffold_109:13592- 15221
Transcript NameFunction/comments
Hyaar_Emoy2809775nitric oxide synthaseinteracting protein putative
Hyaar_Emoy2809776hypothetical protein

Sequence
1629 bases(100 bases per row)
TTCTAAATACACGTTAGTGATCCCACCCGAGCTTCGTTTACGTAAAAAGCGATGGCTAAATTAGGCTTAATCTGGACAGCCTGCCCGTATCCATTTCTTT
TCTACTCGATGTCATAAAAGTGCGTTGTTTATAGCGTTCTCTATCTTAGGGTGATTTCGACCATGAGCCGGCACAGCAAGAATGCCACGGCGACGACGCA
CTTCACGTACCGCGAGCGGGAGGCAGCGGACCACGGAACGCTCAAACGTCGTTATGGTCGTGACTCTCAGCTCCCGTTTGGCATGTGCTGTCTCTGCTTG
GCGTCCACATACAGCCGCAATCCACTAGTGTCGCCTGCTGGGTTCGTCTACTGTAAAGAGTGCATTTACGCTAATTTATTAGCGCAAAAGCGCGCGATTC
AGGATAACGTGACGGCATACAAGCACTATGTCGCGTCACAAGCACGGAAAATACAGGATAAAGAGCTGGACACCGAGCGCAAAGTAGTGACGAAAGCACT
GGATAACGTGCAAGGCGTGGTAGCTATCCTGAAAACTCAGGATAATAAGCTCGCGGCGTATCAGAAGCTGCAGGAAAAAGTGGATCGAGCCACCGACGAG
GACAAGCGCCAAGCAATGAAGAAAACAAGTTTCTGGATCCCGGACTGTACTCCTACTGAAGAACGCAGTGTAGACGAGCCCGATACAGCCCCTCGCGACC
CCATGAATCCTGACCAATTTCTAAAACTCAAGCACTTGATGCCGGTGAAATGTGAGTGGATTTCTAACCGTCCAAACGGTAACCAAAAGGTGCACCATGT
GGTCTGTGCCGTGACAAAAACGGAGATTGTTCATCACCAGGCCGTGCTGCTGCGACCGTCTGGTCAAGTGATCCTCGAGAGCTGTTTAAAACAGATGGTA
AAGCCGACCATGACGTGTCCTGTCACGGGACTCAAGCTCCGCAAAAAGGACATTGTGCACTTGCAAGCTGGAGGCACGGGCTTTAGTGCCCATAGTACTG
TTGAAGCTAAAAAGTATCGACCGAGCATGACGTAGATACGTTGGTGGGAGTTGTTTTTCGCAGTCGAGGAAGTGGAGAGCGTGAGTGGAGACGGAACGGG
ACGGTGGGACTTTGGTGGGGACTTGGGAGAAGCTTCTTTTGGGAACATTTTATGGTTGAAGGTGGTGATCGTGCATAGCAGTTGCTTGGCTGAGCTATGA
GCTACTTACTGCAGAAGTGCTGTCTGTGGATTTGTTGTGATAGAGTGCTTGGCGACGGAGATTGTTGTAATCGAAGGGACAGCGAAACAACGAGATTTCA
TTGAAGGTGTGATACAAACTCGAGTCTTATTGCAATGAAGCGGCTTTAATCAGACGTTCATGTTGGAAAACTGGTCGAGACGAAGGGGTGCGACTACACG
TTGAGTGCCGTACGCTCGATACAATGCTGCTTGGATAGCATCCGGCTCTTCTCCTTGGCGTAGCAGTTCGCGGATTCCTTGCAGCGTTTGGTCACTCACA
TCGGCGATAGAAAAGTACGTTGGCTGTTCCTGCAGATCATCCACTGCTCCTTCCAGTTCCTCTTTTGACTTCAGACTGACGGTCTTCTCCAACAGGTCAG
AATGGGCTTGACACTCTTCACTTAACCCG