Description :
From Genome Similarity Track
Location :
Scaffold_40:1359- 5104
Transcript NameFunction/comments
Physo_538145YapH protein
Physo_538150PREDICTED: uncharacterized protein LOC101236728, partial
Physo_538136AAA ATPase domain protein
Physo_538141PREDICTED: zinc finger protein 628 isoform 2

Sequence
3745 bases(100 bases per row)
CGAACTCGGTAATGTTAAATCTCCAGTGGAAGCAATGTTTGGTTGTGCAGCTGTAGACAGAGTTCCGGTTAATGTTGTAGCACTTAGCGATGAAATTCCA
GATACTGCACCTGATGAACTAATTGTCATTCTTCCTGTATTACTTGTTTGAAAGACTAAATTGTTTGCTGTAGATGTTCCAAAATAAGCATCCCCATTGT
TAAAATGAAACAGAGCACATGTTGAAGTACCATTTATAGATCTAAACGATTGCCCATTAGCAGTTAAAGTAGCGGTTATTAATCCTGTCGTATTCAATGA
TGTTAAAGTTCCAACTGAGGTAATATTTGGCTGAGCAGCTGTTTGAAGTGTTCCAGTAATTGATGTAGCCGTAAGAGTCGCTAAAGTTCCAATCGATGTA
ATATTGGGCTGAGCAGCTGTTTGAAGGGTTCCATATAAAGTTGAAGCGGATATATTCGTAGCTGTCAATGTGTTATTAACAGCTACATTTCCATTCGTTA
ATATTGACATTTGCACAGATCCATTATTTGATGCAAAAGTCAATGGATGATTTGAAAACGTTTGGAGACAACATTGAGTCCCATCGAACCACTGCTGATA
AATTACTGTTCCATCAGTGATTTGATACAATGAGTTTGTTAATGCTGTCGATCCGATAATATCTAATTGTTTAGCTGGAGATGTATTATTAATGCCTACT
AATCCAGTGGATCCTATCGTTATTTTTCTATTCCCATTTGTTCTCAAATGAAACTTATTCGCTGTTGTACTGCCAAATGTCTGATCTCCAGATACAGAAT
CAACAGATAATGAGCATGTGCTACTGGACAGGGAGTTATTACAAGTTATAGGAGTAGATCCACTAATAGTGAGTGTTGATGAAATTGTTCCCAATGATGT
AATGTTAGGTTGTGCAGGTGTTTGAAGCGTTCCTGTTAATTGTGATGCTGAGAGATTATTAATGTTCGCGATGTCTCTGTTAGAGTCAACCGCAATCAAT
TTCCCAGCGGAAGCTGTTCCTGGTGTAATACCTGACAGCACACTCAAATCAATCATTGTTCCATTTTGATAGATATTTCCAGTGATGTACAAATCCGAAG
TGTAATTCACCCCATTTCTTTTGTTATATCGCAAATCGCCAATACTAATAGTCAAGTAATCCAATAAGCCGATATAGTCTGATGGATTGTATAAGGATGG
AATATAATTAGGTGGTAGCATTTTGTAAAACGATCCTTTATATAATATAACAGATAGATTTGTCATACAAGATGAGTTCAATTCCTGATTTTGGTGGAAT
GCTCCCAAAGGAGTTTAAGAAGAAATCGTTTGGAGTAAACGAAAAGCTTGGTATCCAGAAGCTTTTCCGAATGATAGTTTTAGGCCCAAGCTTCTCTGGT
AAATCAAATCTAGCTTTTCATATACTTAAAGAGTCTCCACACGTCTATAGTCACCTTCATGTCATAGCACGCAATCCTGACCAAGAGTTATACGATTACA
TCAAAGAGAAACTACAAGGTTTTGTAACGTTTTATGATCCCGATGCCCCTCCAAGTGTTGATGCTATCAAAGAGATTCCAAATGCTTTACAACTTGTTAT
TATTGATGATTATTCCAACGATAAAAAGCTACAGAGAGATTTATTCAGTCATTTCTTTACTCGAGGAAGACACAAAGGACTTTCAACAATCTTCATAGCT
CATAGCTATTTTGCTACTGACAAGATGATTAGATTGAATTCTGAATACATTGCTATTCTAAAAGCAAATTCAAAACGCGATCTACAGCTAATTTTGAAAG
ATTTCAATCTACCTGGAGTAAGTGAAGATGATATCTACAGGTATTACAAACAAGCAACATCTGAAAAGGGACAGATGTTGTTTATAGACTCTGTAAAGCA
ACGAATTCGGAAGAATTTCAAAGGTGAAGTTTTTAATTAATTTCTCTCATCGAATATAACCGTAAACAAAGTTTACTCTGCAATCTTCAATTCCTACAGA
TCGAATATTAGAACGATGACGAGCACTATCATTTTTAATCGTAATAACATTGTTTCCAATGGCTTGAATAATACATTCAGATTCAACTTTACTGGATCAA
GCGTGAATTTCAAAAATCAAGAATTTGCTCTGTCGAGCCTGCAGATTTACAACTCTCAATTCAACATTAATGGAAGTTTATACAGCAACAACACGTTCAG
CGTTTTAGTTCCAACCGCAGCTACTTATCAAACTGTTTCGATCACGCTTCCGAATGGGTACTATTCGTATGCAGATATATCAAACTACATTCAGTCTCAG
TTAGTTAGCATTGGTGCATACTTGATTGATTCTCAAGGTAATAACGTTGTGTATATCGCTATGAGAGAAAACGCAACGTATTATTCATGCGAAATTACTT
GCTTAGCAACACCAACTTCTGTTCCAAGTGGATATTCACGTCCATCGACTGGTTTATACTCATTAACCGGAACTGGATTACCAACCGCTACTAATACTCC
TCGAATCACTGTTTCAAACAACGGATTTTCAAATGTGATTGGATTCAGTCCAGCAACGTACCCATCAAGTATTCAAACAACAAATCAAGTATTTTTGAGC
AATATCTCTCCACAAATTAATCCCGTCAGCAGTTATTTAATTCGTTCTAATCTTATTAACAATCGGGTTAGCACACCACCTGATATTCTGACTTCGTTCA
GTCCTCAAGGAACATCAATTGGTCAGTTGATCTCAATTCAGCCACCTGAATATCAGTGGCTCTCGATTAACGATGGAGCATACAGCAATATTACTCTGAG
CATCGTCGATCAAGACTTTAACAATGTTAAATTTGAAGACCCCAATTCATTGATAATGCTATTAATTCGTGATAGAAAGGCTCCATAGGAGCCCAAGTTA
TTTTCAATAACTAAAACAATAATTGTAATTATATAGACTCGATAATTAGTAAGACTAAGAAATCTCGATTTCGTGTCTTGCGCCACTCAATCTTCGATTT
AATGTTTCCAAGTTTTAAATCTCTCCGCGATCGAAAAAATAAATTGAAGCAACTCGCTGAGGAGAACAGTGAGGAGCTTCAATTAGCACGCATTAAGAAT
GATCGATACAAACTAACGCAATGGGCTACTGATCTGGATCAAACTATAGATAATTCGAAACTTCAGCAATTGCTAAGGAAAGTAGCTCCAACAATGACTT
CAGCAGGTGTACAAGCAGCTCCATCAATGACAACAATGGGGATGCAAGCAGCTCCAACAATGACAACGATTGGAACACAAGTAACTCCTTCAATGACGAC
AATGGGTATGCAGGCAGTACCGGAAATGACAACAATGGACAGTCAATACGATTTAGAGGACATTGGAGATGAGGAAGATTCATTAAGTGATATTGATGAT
TCGCGAAGTACATATGAGTTTGGAACTCAAGTTGAATCAACCGATTTCAACTTTCAAAAGAATGCCCGAGAAAAAATAATTGATCAATACACCATCAATC
CAACTATTATTAAAAGAAAGGTCAATCCAATTCTAAATTCTGGCACTCCAGATAAAAACGTCTATATTGGAACAGATGGCAAACTTTTCAATGTAAATAA
CGGTAAGTTAGCAAACAAATCACTAAATAACTATGATTGGGTTGCAACGTATGATTACATACTGAATCTTATTGACATTGAGACAGAAGATACCGCCGTT
GGTTCGTCGCATCCGTTTGGATTCAACATTGAGTCTGGAGCATAC