Description :
From Genome Similarity Track
Location :
Scaffold_3355:1359- 2565
Sequence
1206 bases(100 bases per row)
GCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACC
TTGGCAGCTGATACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCTTGCTACCTGGATCTAGCGAAGTCTTGTTCACAAATGCATAAATGC
AATACCTAGAACGCTCGGCTCGTACCGGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACATCTGGCAACATCCCTCTGTGCTTGGC
TGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGAGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAGTGA
TCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCGGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACCT
GTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATC
GTTGGATGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGTCGTGACTTGGTGG
ACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCC
GCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTG
TTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGAT
CTGCGGCGAGCGTGGTAGTATTGGCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGG
ATCTGCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCCCTCATGAGGGC
CGACTT