Description :
From Genome Similarity Track
Location :
Scaffold_534:13588- 14865
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_534-fgenesh-gene-0.3Glutathione S-transferase

Sequence
1277 bases(100 bases per row)
CTCATTCCCCAATCTGCCTTCTTCCAGCCAAGCACGACAAGATGAGCGCCTACCCGAACATCAAGCTCACGTACCTCCCCATCGCCGGCCGCGCCGACCA
CGTGCGCCTCGCGTTCCACATCGGCGGCGTGCCCTTCGTGGACGAGCGAATTTCGCACGCTGCGTTCATGAGCGCCAAGGCGTCGTACCCGTTCGGTCAG
CTGCCGATCTTGGAGGTCGACGGCCATGTGTTCGCGCAGTCGCAGGCGATGCTGCGCTACGCCGGCCGCCTCGCCAATCTCTACCCGACGAACGATCCGT
TAGCGGCGCTCAAGGTCGACGAGATCCTCCACGGTCTCGAGGAAGCGCAAGAGAAGATGTCGCCAGCGTTCCGTGAACCAGATGCTGACAAGAAGAAGGC
GATGCGCTTGGAGCTCGCGGAGACCACGCTCCCTCGCTACTTGAGCATCGTGGAAGCGCGTCTCGCGACCAGCAGCAAGTACGCTTCGCTGCAAACGAAA
GACGTGCTCATCCACGAGATCGCGATCTACGCGTTCGTCAAGAGTCTGCGCGCCGGATACATCGACCACATCCCGGTGACAGTCGCCGATGGCTACCCGC
TCATCGAGCAAACGTTCCAGAAGGTGGCGAGCCACCCAAAGGTGCAGGAGTGGTTCGCCATCCAGCACAACACGCCAAAGCTCAAGCTCACGTACCTCCC
TCGTCCTGGTCGCGGTGAGCCGATTCGCCTGGCACTTTTCCTCGGCGACATCGAGTTCGAGGACGAGCGCATCACGGTTGAAGAGCTCGCGCTGCGCAGA
CCGGAGCTGCCGTTCAACCAGCTGCCAGTGCTCGAAGTGGACGGCGATGTGATCGCGCAGTCGCTCGCGATCCTGCGCTACGTCGGCAGCCTCTCGGGTC
TGTACCCGACGACGAACCCGATCGAGGCGTTCCACATCGACGAGCTCTTCTGCCTGATCGACGACCTGCACAACATCTGGGGACCATCGTTCCGCGAGAA
AGACCCGGAGAAGCAGCTCGCGCTGCGCAAGGTGCTCGCGGAGGAGACGATCCCCAAGTTCCTGGGCCACTTGGACAGACGCACGGCGCAGCACTCGAGC
GGCCCGTACGCGATCGGCGCGAAGCTCACGGTCGCCGACCTGGCGATCGCTGCGCTGCTGAACGGCCTCAAGAGCGGCCACATGGTGGGCGTGCCGGCGA
CGGTCGTCGACCCGTTCGCCAACCTGCTCAAGATCCGCGAGCTCGTGTACGCCCACCCAAAGGTCGTCAAATGGTAC