Description :
From Genome Similarity Track
Location :
Scaffold_79:135867- 155477
Transcript NameFunction/comments
Phyca_LT1534511242Hypothetical protein
Phyca_LT1534555884conserved unknown protein
Phyca_LT1534128884Transcription elongation factor (TFIIS) family protein
Phyca_LT153446076Hypothetical protein
Phyca_LT1534511250Hypothetical protein
Phyca_LT1534555890WD domain-containing protein, putative
Phyca_LT1534555892Sporangia Induced Dynein Regulatory Complex Protein
Phyca_LT1534128848presenilin
Phyca_LT1534555898Hypothetical protein
Phyca_LT1534537237conserved unknown protein

Sequence
19610 bases(100 bases per row)
gcgccatcgtcccaagtaaagtcttcttccggccagtttgtatcaggacaagcaggccctaccccgcgccctctatctataaataaaatgatgggatatg
attggataacgactcttccgatttcagtattgaccaatgagatgataaagtatccctcggcttcaagtgtatcaatcaaatcctaactggactatggtgg
gtaggacgctggtcgtaggcggaggcttgacaggtgctgccttggcgcgactgttgcaagaagccaagctgaccagaggatatgtgtcggacgtcatggt
ctgggaccgcaatagcatcctaggcgggcgtgttatggccaggtaaagcgacagatttgagatgtatcaactgtccttgtgctgacgaaattaatttgtt
aaaggtccttcccgaagcagcgaaacgtccacgtggacatgggggcacaatactggacgcccaagtcagatcacaacgatgatttccgtcagaaattgac
gaacagcggccatttggtaccattcgctgagaatgaaatcgctgacgacccgcacaaaggaccagtcaagtcgcacctcgtttctccagacgggaagggc
tttcgggccatggtggagcatttaatggaaagtgagtgtgccgaggaaatgactggagattgtcgtggttacgatttcaactgtgattaggcaccgagag
gaagttgtcgacccacttgaagaattttcaagtactagacgacaaccgcattcaagtggctacgaatgacgggaaggaggaagttgtggacgagctggtg
ttgacatgccccattccgaacgtacgatccttcggttgaggtttctttcgtgtcgtctcaatgctcaattgatgaggtgctctctgtaggtcctttcaat
tctcaagaaaagcaactcttttcacgtggcgccggaaattatgcgcgcgttggaaagcgtgacctactctcagcgttttgctgcagcctatgtcttcgac
gaaaaggcagttccgatagtggaggagctggtgtggacggccaagtacgtttccaacgacgagagtgatgtcatccgcttcatgtgctgggatcatcgca
agaagcgcgctagtgacaagtctccgccgtcgctgatcgtacacacgtcagtgcccttcggctccacattcatggatgacgctcgccccaatgacgagat
cctgggtatcatcaccaaagcgctgcgagaggtattaccgtctcttccagctgaacacgatgtgcgtctgcaccgttggcggtacgtttgctattgtatt
tcgccagtgtccccagatgctttgactcatgacaaacgtaaagtatctcgcaggtgaccgtgccttaccacgatccaagcactgcggagggagaggatcc
agtagctgctctcgttctcagtaccaacccacgcatcatcgtagctggcgacagtttcctcggatcgggcttcgacaattgccttttgtctgctaaaacc
gctgccaactttttacagggcaaggagattggaagttccctttgataattgccacctgtcagaagtgaagccatgtcacaaattcttctcctaaccaagt
tcatttttttcaaactagaattgtcaatgctgtcacacgaagaaaagattcaggagagaaattcactcatcagtcattcatcaatcgcaaggtggaaagt
ctacttacaacttggtgtacgtgtggtgtacacattcaaactatagtgaaactctgtgtccccaatccctgatttgttggcatttccttatccacctcgt
tcggttagacactaagaattaattcgagttacaggcggctatggatctcccggagctaaaaggtaggctgcttctactgctacagcgtctccacgtaact
gagatgctaacactgaactctgggtaggttatttacgcaagaagtcgcgccacgaccggtggcaacgccgctactttgaagccacgacgcactacctcac
atactacaaggtaacactcatttggatatagctgcaatgcccataccattctaacctatggttgtatcgacttttagagccgagaaagtgagaagttgct
ggcctgtatcgacctgtggcgcacacaaaccatcgactttaaccctgtggacagcgacaagctcgagttctccatcgccattggagagcagtcgtactta
ctcaaggccgacagtcaggatgacgctgctcgatgggttaaggggctgcaggcacggcaacaccggcctgaaggcacaccctctgaggtctttagtctcc
gaagcgagcacatggacgctgagagcgacgcgtccagtgaatacggcggtcgacgtccgcgaaacgcgtcatcagactcgggtagtcatcgctcttcctt
gtcatacgtcgagacgcagaaccccgtggtgccgaatgctgctgctatcgccaggttgtcactgtctcacgcagacgctccgaacccagtggtgccgaac
gccaatttgatcgcccgctcgtcgttttcgcacgcggaagccttgaatccagtggtaccgagtgcgaactctagtccgccaaagtatccgatggtgaata
ccaaccaacaggtgacgcggtcagttgtgacaccgtcgactgcagttaagacagcggaggaagagactgctgccaacgcacagtgctgtgcgccatgcgt
gatcatgtaaaatgcgatgagaggcgatagtataattctcctcctaacggcgatgcaggcgagttaaaggaggctgattgacagttttttttcgagccgc
ggatacagctatcagtcgtctacgcctgctgagctgtcctttgtagaccgtacgaacgccacaaagctgatgccccatcgagtgggcgacactcggctgc
ttattaaatacactacgtagtatacaacacaacaagtggactcttgaatcgcaccttctccatcgtcaagaacactcggtgcacgcgacctctattaccg
tcacgaggttgatcacgctgatgaagttcatgctgttgtagatgaggccaatgtgcgaattgatcttcttgacgctggtcgccgacaattggtagaagtt
ctacgaagagcggaaagagaaacatgcgcatgggttgcaccagtaagtgagctgctgcttcgtcgtaagtgcaacatgctggttccagaagcccgttgag
atcggatcgtagttcagggtcgagtggcaaatgaagtcatcggaaacctcagtcagttgcagtgttcgctcacagtttttcgctgttcttgtttcccacc
gcgtagtccttgacgtcatggccgataccagcaccgataacctcgtggctgggttgttctgcgatcgacgtactggagcatcgtcacctagcccacgcgt
cacaacgagcactgaactagcatccagaccactcgtcgacccacccagaaataaaatactcgggttcgacgccacatccacactggtcgtcacgtgattc
ttctgctctacggacaagtaaccatttcgccagcattctccatacaaaatatttattttgtactttgctcaacctactgtcacatgtcacatattcgcac
gactcgtaacactcttggttgttgtgattaagtttggaaggtatgtagtgattggtcaatattcatttttgacagtcaagtgtcgaaaacgtaaataccg
ggagcattgctactagcaacagggacgactccacaccagcgccgatgggaagctccgacggtacgtctcgtgcttctatagcctatctcctcgcactacc
actggcctcctgcatgttcttaccccatttgctgcctacctgcaccctgtatttcgacagaggatgagcgcaaaaagcgcagtatcaacgagatgttcgg
cgatgaggactcggacgactctggcaacgaacagatccctcacagtacgtatctctctttataaagtggttggctagcacaaagtctatccatccacgca
cttcacaccctcgtagcccatttcgttactgagttatggtattttcgacagcatcgaccaccaccacagctgatgcttccgggtattttcgacatgcatt
ttcgacacattgtactttatagctaaatattttattgtgtattactgctactgcaaagtttattcggctcggactcggagagtgacgaagaggaagagaa
acctgccaaacgcccatcgtctccaccttccaagcgtgtcaaaaagtcccgagacgacgataaagaccgcaaacgccgtccagaaggagacgaatacgac
tctggggacgaagtagtggccaacaaggatgatgatgacttcattgacggagatgacgacctagcggacgtgctgggcgagtacgccgaagaccgtcaac
agttcgacgacgagcgtccgctggacgaacccgagcagactcagcagcagaaggacgacttcttcgatcgaacgctcaagtccttaaagactggacgctc
ccgcactaaactcagcctgtcaccgcaggagatggaacagatcacgcaggaggtgctctaccgcatggacaaggcttacgccgatgacctcgcgagtatt
gcggaacgtcggcccgctctggagaagatcaagttcgtggacaacgcgctgcatatcctgcgcaagatccaattccagcccatgctgcttgatttcgacc
tgctcacggtacgtatttgtttgctctagagaattcgacaagggtgctaattcatgtttttaatgcgggagcagattgtgaagaagtggattcagcctct
ggacgacggctcgctgccgaacgtcggcttacgtaccaagatgctggagatggtcagcaagatgccagtctttaaggagcacctgaagcgtagcgggctc
ggaaaggtggtgatggtgttgatgaagcacccccaggaggtacggaaaggtccaagcgtttggtacggaaagagcttgattaagatactaatgtgttccc
gatggtttacagacacctgagaacaaggaactttgccgcagcttggtagaacgctggagtcgcgccgtgtttaacaagacgttggacttttcgaagctcg
ccgagctggaagctgagaaggcggagaatgagatttaccgccgtcgtgagcgagcgtacgttgttttcctcgtggaatgctgttgtttctcttgcctcag
acgtgttggtgttgtacagtcgtagacagaagaagtcaaagagcaaagtacgcaccacggagcgcggtggaaatgtctttagtggtcgcaatgccgatcc
ggacgtgaagcccgacatttcagagcgtgcagagctgccagagcagctgcacattgatttcttgcttcgtcctcagtcaaagatcgacatgaacgccgtc
caagccaagaaggtggacccagattcgcgtaaggcgcgtctggccaagcgtatgcaggagattgctaggcctggcaggaagaccaagcgcgccaccggtg
tgagcatcgagggcagataagcggtccagtctgctggcaggagtcgagccctgtaacatgtgtgccactttgatagccatcttttttgcatgttgcatct
tgtatacacgctcctgttgctcgattattccctcgtgcattgccattgtctgtactaacttttgttgtgctcttcagtgttgggatggtgccagcataac
gtcgcgctggactgaaacgacgacattttagcggagcccatgaaaatagcctcacaatcgagccgacatggtgagcaagcagatgcgaggagggcaagct
actgggacggacagtagcgttaatgatgaagcagttccagatcaccagagaaggagaagtaagtcggatgaagaggacaagaaagatgatgtgaacgatc
tacgagttcctgatcacttcggcaaccagcaaggcgaactggcagattctgagcgtgtgtttcctgctccaacaagccacgtggcagctctgaatcgcga
attgaagtctcttgagacccgctacttccgaacgagacttaacttggagaaagtcaccgagaaggtaaggaaggatcgttatgtccatcctagctctttt
tttttgctaactcttagtgttattgctccagaatgaccaactgcgtcgtgagatgaagaaagtagcaggccacaacacgaaacaggaacgagaaatcttt
aaacttcgacatttggtacgtgtccgcttcttcgtttgctctgacatttcgtactgatgaattctacctcagattgatcgcatccagtcggagcgcaagc
agctcgagcagcaggcgatctacaaccgagactacgcaaagaaaatcgagcatcggttctttatggggaccaaaggcaagtctctggcccagtgcaatct
ggagctcagtacccgcttacgtgcactggaagaaactctcaagaagaagaacgaagctttggaaacgactcagcaagaacgagatgaagccagagacaag
ctttccattgtacagcgtgctttggacacgcgtctggactcctacgagctcaacggttgccttcacactggtcttttattcgagatcgcaaagctacaag
atcacgcggaggctttggctctgcaattggctcaagaacggaaacgtgcatcggtattaggaacgcagctgaagacgtctcagaagcgcgaagaggggct
ggaagatgctcgaacagtgcgcgaagctatgcttgccactttggaaaaggagcgagcagtacttgatgagcagttggcacagctctcaggcgacgttaag
accgcagcgtgcgagaaggcgacactgctgcgtttcatccacgaacaagctgaagagaagttccagctggaggcacgactcaaagatcaacaagctcagc
gacagcaggaaaaagagagatcgcagcacgcactggaacgctgggaagaggaaaagcagcagctgaagatgagccttcagaattcacagcaggagacgga
ggcacagcgagtcgagcacgaaaaggttctggttgctttacgtgaccaacaagaagccacttcagccctgagagctcgagaaaccgagatgaatttgcag
ttggaaaggttggaaagcactcggaagaagtgggaggaggacttcttggctgctaaggacgtctgtcgagagctgcaagcaaccgtcgatcagcatgaag
caactggacgccagttgcgttcagagctcgacgcgttggacgccacacgtcgcgaactactcgcacaactggagacgaagcagacggaggaacgagctct
tcgtgaggcgatggaggccgctctaaaagacctggaagctttgtccaaacagcgcaatgatgcagccaaggccatgagtgaagccgtgaccattagtgcg
tcatcgcttgaagagcaacaagcgctggaacatcaggttgaagcgcagcgctcacaactggagaagctcaggaagtccaagaacctgctgcaaaacgcca
tgctcgaacaactcgcggctctacgtaagcagctgcacgtcgaacgacgccaaagaatcgaagcagaggctcggatcaagcacgtgacagttccagcaag
ctcgtgtcgaccggagacggtggactgggaggtgccacacccgttgccgtccgctccttcaccttctccagcgccacttcctccgtatctgtcttcaagg
cgatcagacacagacttaccatcagctttgtcttcttcttcttcctcagcttcatcttctgacgaggacgtctgcgaggcacttgaagaagatttcagtc
cggtgaaacgagctccttcgccttcatcaccagtgttagaagatgatgaagcaaacgtctccttgttggaactcgcgggggatatcgacaactaggacaa
catcagtatcagtagcaaaaataaataacaattagctttcagcgtcgatgagccagcttctcctacatagaacacaagatatcgccatgcagatagccca
catgcttgcctccccacgtcaaagtcacatcaaaagggatcggctttgcctcacacagaacaggagcagcgtgcatcatcaagtcggattccttgagaca
cagcacgccttgacctccgtggcccttctcagcttcgatgctgatcgcaatgtgcacaccgccgttcaccgccttggtgatagctgaatgcgtcacgcca
ttggccatcgcctccctccacgccactgtacggaagttcgtgtacgccaactgcgattcctcgtcgtcatctactcgagcgctggactggaatccgttct
gaaccaagtgcgccacctcgtagaccttccgttgtagcgcataaacgtcctcagatggcaaagggaagatagtggagatgctgacgggttccactggtac
tagttcgagtcgagaggcagcgagagcagagagacggtcgttcgtcatggccaaaggttgagttccttccggtccaactgtgaagtccgagtactgattg
ggtgtcgtcgtcgccctcgagcttgaattgcttccagaccgtaggcggctctttcgaagcactcgtccaacagcttgggcaatcgatgattttctgcggc
tcacggagatccgcacactgtgtcgggaagactcaccgctgctggttgtgctgttcgaattgacggcgccacgactactgtggcttcgttggccagtcgt
tcgactgctcgagtgattcgagccgtgccccctccagcggtacccggtagtctgcgcaactgagcccccatcacggtcttcgtacgtccagatgttggca
tccagcttcaccagtttgatcttaaactcgtgcacgtcccgtttgtcacgtagcgcgtggtttcctaggcgtaaatcggcaatggcagcttcatccatgt
tgtaagaaaagaaccggtcgatctccagctcgtaaatactgcaaacgggtttgtgtgtagatgtcacgatgtcttcacacgaccagtagcccacgttctt
aagccgctgcttcgtgtcactcaacgaatgggccaggatgcggtccttatacgctggtggggaatctcccacaagcatctcctcgtcggcctcgcagaaa
agatctcggcatgaacgctcaccgaccatcgagaacgtcgcggcgacaccaatcttgcgcgggaaggaaggcaggaatcgaatcggaggctcttcgaagc
cagtgaagatctccttcgcctcaatcgaagcacgcaactcgtcgtaccgaagcacttccaaccacttgcgggccgtgttttcagtgaccaggtcggactt
ggacaaaagatctcggattttcttgtggtttccacgagaaaaaggcacgaaatgtccacttgaccccagtcgatcacttgagcgttgcttgttggaagaa
ctggacagaccaagacgagcttctggggaatgtgtgggaagctgtttgtccaagaaagaggcccaattgctggatttgggcgccttatcacccttgccgg
cgtcatcctggatgataatcaccaagtcttctggatccttttcgtccagaactggtgtcaggatgtctggtaactgcggttggtccactggagaccttaa
cagagtaaacggtaggtcgtcgtcacaggaagtgaacacttcttcataaatactgtcaccactcgacgaagatgaagcttcggcgctgctccgctgcatc
tcccagctgctatcgctttcctcaaatattgtatggctgtactggaagtcagcgctcttcttgccggctgtgcccttggaactgcgaattgccttgatct
gagcttcaatcgcgtggtctgtcgctctcttcaaagattccgccttgtatgcttggtcgattgaagctgccagcgtcgacgtagacatgtcgacgtcgta
gttcaaattgccggagaggatagtgtggtgatacagattcgggaaatcaaccgcagctcgatccgcatccattccgaacgagtgcacgagacttgaagcc
actgcgtgtttcgcgaacatgttgttttccactcggtacaagcgctgcgatgagttgctgcgtgaagtgctgagattgcacgatacaaacgcgatggagg
cgtcgaagtaccgaatggggatgcctacaacctcattgaaagttttccgctgtgcccagatccgcccatcggctgcttggaactttacatttccactggc
gtcgtcggcattatttacaaaaacaatctgacaaaccgacgcctgtagtcacaatacaaggatgttagtgacaatacacagcaaaaaggcacgtttgata
tcacgtacatcttggacgtgacctcgcactgccgtcccagcaatcgacgtaatagaacggtaagcggtggggtagttcacttggagaaggtatcctcgaa
ttacctgctcgatggtctgcacttcaacgcagtgctgaagagagaacacgtacaggtcttttcctgccgggatccagtcactgaggttcgtaggacacgc
agtccagttcatgtcgaacgtagtgacgaagatggtcgctgtacccatgtgatgccgctcctgctctcgtagccgcaccgattggcgcagcatatcctcc
gacagcttgctgttcttcgtggatgacacggcgttgctcgtccagggttctcgaacgtgacgcacgacccagatgtggaatttcccgtaaatgacggcgt
tcacgaagccttgaagtggcacgatggtcgcgtgcaggaagtcgagcgtgaaggacgtttggcctgtatacgtggcgtatcctctatccaccacggctgg
cagccagcaaaagatgaagccggagatgtagatcgtgaggttgtgcactaccgcgtagtacgcgtcgttggcgtcatcgttctcgtacgtcttgagtctc
cgcttcatgttgatcttgacgaggacgaggaaaacggtcatggcgatgccgccagcgatgacccagaagtacaagacgccgaacatccaccagagctcct
cggtcgagtcgtgttcgaccaccacccagcaccagagaccggcatctccgaatttattgaaaatgaggcagatggacgggatcccaacggtgaagagcat
cgtgctgacgatgtaccacttgatcttcttcatgagcatctgctggtcttcgcccatgcaaacccagcggtagagattgagagccatgatgaagttccac
gcgatcggagctccatctccgaaagtaataactacagcaataaaataaatactcattagtaaaacaaaataacaaaaaaaacaattatcaccgtactgaa
ggcttgggccttgcaaattggagtcacagcttctcctgcagcctggtcgaacgtttccgtcggtaacacgccgaaagctcggcctgtagcgccgaaaagg
tcctgtcaaaatttaaattaattgtcaataataagaaaaaaacgtcgaaaatggattttagacataccaggtacgcgataatatggatgagctctttggt
gacgtcgaggtgatgggccgacgcggcgtagagcgacagggacttggctttgagtcgacgcgcgtaccagtagcggccgatgatgtagaaggcgccgatg
atggagagtacggaggtcgtggccgacgccaccgtctggtagtgctggtggcgcgcctcctcctcggacgttggcgtgcccatggcgcccagcagcaact
caagaagtgctggggctcaattgggaagtgactggggttccaaaaaactttgcagagaggcaagagaagttgacgtgcataattgatatttggttacaca
gttgtagtaaataatagagtttgtaaatgataagtttaaacttcattttaggatagaataataaaggttattatgtgtttgtaaaatgtgctatggattg
gttaaagaagcagtgacacacggacgtcgggacgcgtagaaaagcgacggtctcagcaaccgtcccactttcgattggcgacctacatgcaagggcaacc
ttgccctttgtagctgaaatccatgtgaaagatgtcgcccagcctgtccatcgcatggcaaaagtccgatggtttccagcgtcgaaatgcgcggcagttt
aatgaggttgcagcaactggtatcgcttctctatctgtgattcggattggagcttgaagctggtgtctgcggaccgtcttcgtgcatggcttgcaccaaa
tcgagagccacatcacagcctcaaaaccggtggtgggcttctacaccttttcaacttcaaaatggcaaattcttagttcaatgtggcaaaatgtaagttc
aaaatgacaaatcgaacaaagatgctgaaacgcaaaaaattatattcagcatgtatacaatgaagcagaaccaccgcgacaacaactaccgcaaccttcc
ccacatcaaggtccttcgccgtgactacgttgtcgacctcctttcctataaggctgctgaatataattttttgcgtttcgcatctttgttcgatttgtca
ttttgaacttacattttgccacattgaactaagaatttgccattttgaagttgaaaaggtgtacactggagacgtaatgaagcagcctttggacaagcct
cggcattgccgacggcaacaagcaggccgagtgcagtcaaggaaagcatcacttgcactgtcaaaataactataataaaaatgctgttttccagttccga
tgtggtatctgcattattccttttcatccaatcatgtacaatggttctgtccacgtctcaggtttgctaattaaccagatttaaggcccgatttacagat
aattcggcgcagataaatatgacttgagtttcaaagtgatgattggttaaaaatggtcaagcatctgaaacgacgcggatacttttccagcattatcgag
ccgcctgaccatctctcttcattcctgccgctatggacacgacggacgcgccacagctcatcgagcacgtgaaccagagcgtgaacttcacgcccaatga
caccaagtggatcccgggctctgcgcgcttcgtggccatgggaatttaccccaaagccaccggagcgttgacaatctacggactcaaccagggagagctc
aagacacacgcggtgcacgagaaaccgcaaggaattaagtgcggaacctttggtgcttcggctctggaggaccgacacttggctacaggcgactatggcg
gcgtcatgagcgtctggtgggcacacgctccgatttgagctgtaaattagttttaaatattgttaaatgctgttgacagggatctggagaaggccgacgt
gccggtatactccgctcaagctcacaagtccattgtgaacgctattgacggctgtgggggccagaatattggcagtggggcgcctgagatcgtcacaggt
ggtcgggacggctgcattcgcgtctgggacgtgcgcgtgcccgatccagtggtgaccttggcgccgaaggagcaggatacagcaagagactgctggacag
tctgctttggcaactcatacaatgacgtggagcgctgcgtcgtggggggttacgacaacggagacatcaaaatgtttgacttgcgcaccaactcgctccg
gtgggagaccaactgccagaacggcgtcgtcaacgtgcagtttgaccgcaaagacattgagatgaacaagctgttggtcactacgctcgagtctaagttc
cgtgtgtacgacctacgcacgtttcacccggaacaaggcttcgcgtgtatgacggagaaggcgcacaaatcgacgatctggcagggtcgattcttgcctc
agaaccgagatctgttcatgactggagggggtaatggtggcttcaatctgtacaaatagtacgtggtgctgcgtgttgtgggctgtgtattattaatcta
actcttcgctttctgtatcccaagccactacccactttcaagaacagccaaggactcggacggtcggctctatggtgtttgtggtacggtggagctgctc
aactcccgagtgctatccacgcagccgattgtcagtatggactggaggtggggagagttattcgagataataactgtgcttgcacgtactaaccttacgc
tgtcagtcctgatcgtgagggtctctgcactttggcatgcttggatcagacagttcgcgtctacatcatcacgaaaacgaacaagtactagacaccaatt
cacaattttataaagaaccagctttattccactgctacaagtccagctgggtttccattcgcgttggaggtgagcattttgaagccgagggcgcggatct
cctcctctgggatgccaaactgtgccagtttctccgtgaatgtgcgtaggctgtcgttgtacgctttgctttccttggccacactgtactgcagcttgcg
gatcttggagttcttggagtccaacagcgttccgagcgtctccgtcacccgacgcgcctggactggatccaagttcgcggccagtaagatctcctgcaat
tgagccccttttcgagcgtgctggtcgtccatcgacgagaggcgctgctccaatatgaggttcttgcactcacccttcttgtggatggtctgcactgtgt
gctcgaacgtgtcgtacagtgcgttacggtccgactccatggtgcggtacttgacggtcaggtcggtttggcgctgcttgagattgtgcacctgctgagc
cagatacagcagtctcgccttggcgttccgtagcgacagtttgtccttttgttcgtccttaagctcgtgtcgtaagtgctccacctcctgaattgcagct
gcaagaggttctgacagtcgcttgttctcttgagagacgtcgtgcatgagctttgtgttagctgcagctttctttttcatagcagcaatctcactcttga
gtgaatcaatcagacgcagattgtccttggtgatatcgttgtagtagttcttgatctgggtaaaggccttctcgtggttcttcatcaggtcgttgatgtg
caggttcttgcgctcttcgatctcgtggatgtccactttgcgacggagctccagcgactcgtgaaggtcttgaagacgctgctggcaacgaccttcaagt
gccgcgttgttcttctcgaactgctcgcgcagcttcatcaagttcttctcgtgcgcctgtttcatctgctcgatctcgtcttcgttggacaggtctcgct
ccttgagctcgagcttcagagattgtttcgtactcctcaacacggtctctctgtggtcatggaggtctcgttcctcgtccatgtggcccattccgtccgc
ctgcacgcgcttgaggttgttcttgtgctcgtagtccaaatgtttgaccttctgcacgtacacgcgcacttccactcggtggttgtcctccatgatctcc
atctctcggtctttcgacatgatctggttctcgtggtcctgtatttcctgcttggtgatctcgtagaacgattcgatcatatcctgcgtagcaagaggtc
agataactttcactattgaaatcttccagagacagtagcgaacccgttcgtgctgcacgtagttgcgatccacttgggccttctccaattgctgcctcaa
catctgaatcacctccttgagcatcggcacatccatcgtgtcatactcggacggttcctccggcggaggttcctcttctttctttcctttctttcccttc
ttccctttcttcttgggccccattgtgatcactaatgtcttctattgtgttgagggctcagctagaactagagggacgttatgtcaacggtaaacgtgtc
cctcgatctcacgtcccttcaatagattttcaaatcgttcatggggaatacgaggtcgaatacgaggagcttggcgagtgtacactacctggacgacagc
tccacgatgtataaggagccgctgctggacaaggaacagcaattacaggagcagagtgacaaggtggaccttggagtggtgattcaccaactcaacagct
tcttcgcagtggtttggcctgtgtcaatagcgatcatctgctcgagtctcgcagcctcatacatctccgacccggtaatgaagcgagccatgacgacgta
catgtactaccaggatatcgacacatccgagctgtcaactacggagaagaccgaggaggcgtttttcaatgctctactggtgatcatcttcatcgccttc
ctgacattcgccatcgtgctgctgtacaagtgcaacggtatgcatctctttgcctggtactgtatgatgtactcggctgcgctgctcgggctcatgggct
ccaaactcgtcgttattgtcctgtgcagtaacctcaacttggtcattgactgtttctcgcttattgtggtcatgtacaatttcgcgatggtcggtgttct
cagtattttctaccagaaggggatccccgcgatctgtgaacgaggttaccttatcgcaaccagtgtcattgtagcttggcagctctctcaattgcccgag
gtaaggtgatcatgttatcttttcctcagttgtgcttataatcctattgtaaattttgcagtggagtgtctggatgttgttgcttctcctaggcttctgg
gacctctttgccgtcatgacaccggtggggcctctccgttgtcttgtggatctcgtacaggagaaaggcacaccgatccctggtcttctgttcgaagcgg
atgtggaagacgctcatattggcaagattaacaggatccaacaagggttaacccccaggagaagatttgctacaagagaaacagtccccgaggaatcatt
tatccgccgtcttctacttgcagaggatactggtcgtacacttcaagactatcgtgcagtaaacgctgccgagttccgacgccaagtccaagcgtttctg
tacgaccaaaactcgcagagccagagtcgaagcgaagaactcgctcaaaagttcgagcggaatcaactccgtctctggagaaacctctacacctattacg
gtgtcgactacacgtccaagcagcaaccatatccgagtattcagactgttttcccgccttccctagacacgtatccagcttacgctggtactggctccaa
ctacgctcttgaacgtagcgaaacccgtgaagacaaatcgatcaagctcggtttgggtgacttcattttctacagtgtactggttgcccgtgcgtcgttg
cacggtttcgacgtgttcgctgcctgtttcctcagtatcttagtggtaagtctccactgtttgtcaatgtgtgtggaaatttttaacaacttgttatcat
gtagggtctgggaattactctttacttgctcgcacgcttcgacgctctaccagcgctcccaatctcggtgtttctgggaatcgccacgtacctactcatg
ctcactatggtctccccgttattggatgaactccaggcaggcaacgttttcggcatgtagatcggaagttacaacgtgtctcggctgctttcggtcggaa
tagcgtggcacgtcgtttctcagtcgttttttttctcgtctgcgaaagattctgttgtaaagaggcaacgtgaacaaggattctcaccaagaggctcttc
ctgcgtatcctgaacgacgaccgcatatggtttggagttccacgttcgacgttaggcatcacgacgccagttcctaggtctaggataggacactgtcttc
gggttaaatttaaggtgcgctacgactcggactatgaacttcagagccgttgaaagtcagatttaagtcatgaaaacgccaaaaatgccaccaaaacgac
gtcgctgcatcccattgcggtgcagcagtacgcaggtaattattggttcgtcaagcaaggtccttgctgcaaggatgcctgaagtgtcaattgcctcatt
aggcactgttagactgaacatgttgcctctttgacccgaaactgatcaccaaaagatacttttcgctgaaccggctatacaacttcaacctggcaaaaaa
aaaccgtcatctgacgaagattggaagtgttgatagtgactcactattagtgagagcgagttgccggcatcaaagtcttttgaagacgaggcggggtgaa
aggtgtccctgtggtccatgcagagagaaaacagattattcgccgcacgtgactgcgaccggttacgtcgcatacctcgtcaggctcatttgcatcctca
caaaccaagcagaacgtctgtaactttcaccaaagtttttttcaattcctggctcaagtttcagtcgtttgcaacttttcgcgaaaccactaagtcaagt
caactgctttttgtggctccactcgttcggttgagaaatttttctcgcaccacagcataaaaaaacacattggcggatcctattatttcccccgatccaa
ggcgttacaaggctctttcataggttcagagcgttcaggcagctcccgcaggtttcaaagcattcaaacactcgccggacgaagctccgcccttcgatcg
cagaagggatttacttgagcatggagtcaacggcagagtggggaaccactacgaaacttgagtcgagactggacgaagcctccgcacagaagcatccagc
cagcacgtggccacccgagagaactgtcgatcaccaacgctcgcagatggtggcatcgtggcacggcactgggatccgccagctccatgaaccgcacgtc
ggtggagttccccggtccgtcttgcagcggttgttagcgaccccctcggaaagtggccccggtacgccgctgcatagtccccgccgtcggtgttccgccg
cggcagctgcagtgacggccatggtgcacagtccgagagcgttcgccagcaacgaccgtcttgtgcttgaaaagagagaccctacggcccaaacggtgcc
ttgtcagtgcttttcacccgtgttcccgacccccgagttcggtagttacgaaagtagtagcaactgcagcagtcggtgcaacagcccagttccaacgagc
ccgttcccggatcgccccattccgtccgacgacgaacaagaccaagacgacgttgtcatgctgcgccaacaggtagcgctgctgatcaagagcttggagg
acgagaagaagcgacgtgcgtccgagcagcagttgatgcagacggtaagttctcgtccttccctccgctttgcaacttgttgtcaaaactgatttctctt
tcgttctggtagaaaatcatcgagcttcaaggcttgatccgtggcaatgaacacgacgagatggagtcgttcggagacaggaacgggtttccttcagctc
gggagaacgaacggctggagaacaaccaagtcagaagatggtcggcaccactggaggacgacgagggagtcgaagcttcgtcttgtggctgctcccggaa
gcagcaggactcgaacggggaagcagccgccaaactgcagctgacgcggctccgcgcacgaatgcacgctattgtgatcgacgcccaacgcgaaactcag
tacgttcactgtaaacagtagaggtattagtcagttccttaccgctcgtacgtgtagatccctgcgatcccaactggaagcgatgaagcgaagacacacc
aaacgggaga