Description :
From Genome Similarity Track
Location :
contig_50:13585- 17651
Transcript NameFunction/comments
g10352.t1hypothetical protein

Sequence
4066 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGTCCCGCCTCACTATTCC
TCGTGAGACTGCATCACACCAAACCGGGTGTGGTTTGCGCGATCCCGTAGGAACTCATGCAATAACGCACCACAGTTGAGATCCGCTTCGTCGATCCAGC
TGGGCTCCTCATATCCACGCCAGTGTACTAGGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGATCTCAGATCCGTGATCTTCTCGACTTC
GTATTCATCGGATCCGAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCACAACCAGCTGAACAAGC
GGGCGATCTGGGAATTCCTTCACCAACTTCAACTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGACAGTTTCGAGCTTGACCGCGTACT
CATGGATTTTCTCTGCCACTCGAAATGGCCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGCGAGATCCAGCTTCTAT
CGGGTGAGGTCGAACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCACAGACCCGCGTATAATAACGC
TGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGAAGTCGAGTACTACCCATCGGGATCGTGGCCTCTAATGTAGATCTAGGATCTCAACCATGTA
CCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACCTAATCCGCTCGGCGTACTCGTCCCAATCCTGTTGATCTAGATC
CTGGACATGCATCTTGAGTGCGCGCATGATCGTTTGAACCATGCGCGCCGCCGTATCGTTCTCTTGCGGTCAGTAAGCTATAGTGGCCCTCTGACGCTGT
CCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGCTCCCGATCGTGCCGAATTACCTCGCTAGCGCCAAATCGGCGGAACACACATT
CTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGTGTT
GCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTG
GGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGATCCGCTGGT
AAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCGACCAACCGCATCGTGAG
ATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGCGTAATCCGTCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGCTTCTTCC
TGGGCCAACGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGAGCTCCC
TCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAATCGGACCACGGATTCTCGGACTGTGACGG
TTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCAATTGTCGCTGAAGGGCAGCTCCGGCGAGGCT
GTCAGCGGAACCATTCCAGTCTCGCTTAACATGTAGCAGCTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAAACCT
GGGGCCTTACAATCAATTTCCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGGTCGAAA
CACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATCTGGTAGTTTCCACAGGAT
CGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACAGGAGCTTGG
ATCTGCCGTCGGGGTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTCCACATCGGACTAGGTGTAATACTGGCAGCCATCGCCCCTAGGATTTCGTCTT
CACCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAACAACCATGC
TAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACACTTCCTTCTCGACC
ACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCGGCGGAAATAGCCC
ATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGCAAACGACCT
ATATGCTCTGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGACGAACTG
TGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAGTCCTCGA
TAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATT
AGCTTCGATGCCATCGTCGGACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCAC
ACGCTTCGAGCAGATTCTCCACCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCCTAACACTGACGGA
CGACCTGGATCTTCCGGTTCTCCAGCCTCAAGAAGATCTGGAGCAAGTCCTGGCTCATCAGGGGGTGGGATCCGTGTAAACCCATATAACGCATTATCCA
GAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGCGCGAGC
TCGGTCCGTCATAGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATCAGAGGC
ATGGGGTAGATCATTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCATTCTTTTTGATGATCACCACGATCGGTG
ATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTCCGCAC
CCGTTGCACGATCGGCTTAGCACCTCCTACATCGATATCACATACGACTCCTCGAGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAACAAGTGTCGC
TTCCGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCACTCGTCATAG
CTGTGATCTCTGGCAATACTGCCATTTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGT