Description :
From Genome Similarity Track
Location :
Scaffold_282:13584- 17464
Sequence
3880 bases(100 bases per row)
CGAGAGTTTCAGGTTCGAAATCGGTATTCTTTTATGAAACGTTCGAACCAAACCATTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGG
TTTGTTCGAGCCTCGAATGGAGGCGTGGGTCGGCCCTTTTGGGTTCGCGTGTTGCCCTTTTTGGGGCATTACCTACTGTCATCTGTTTACCCAAATGGAG
GGCCTCATCTCATGCTAACAATGTTATGTGTTGGCCTAACATGTCCTAGACGACAGCAAATCTTTTGACTTCTTCCTGGATGTTGCAAGAAGTAATCGAG
GATTAGAGACGCCTTAGAGACGCCTTCGGCACCCCCGTGATTCCTTATGCTCGCGATATGAAGATACGATGTCCTGGAGAGTGCATGCGGGTGAAGAGTG
TAATGCACGGCTTGCTGGTGAGCTCGGCGCTGGGCCCGCCTCCGCAAATACCGCGCGGATTTTGGCACGTACTCGCACCCAGTTGGCGCCGCGGCTATGA
ACACCCACCTGTGATACTATTTTCTGCTGGGGAGTTGATGCTGCACAGAGTCAACATTGTGACAAGTCTTCAGTTTTTGTCTGACGATACAGTACAGTGC
GGGGCATCGTCAACTATCCTACGATGGTCGGCAGTCATTCCACGTTTGTCTTTCAAGACCACAAGACCCTTCTTTCCAGCGGACTCCCTCTCCTCCACAG
TCATGCGCAGTCTATTCTACGTTGCTCTTGGCTTTGCGGCTTTAGCTTGCAGCACCGTCGTCGCAGAGCCCTCGAATCCTGACGACTCTCCGCTCTTGTC
GAAGGTATCTCCTGATTCTGCGGCCAAAAGATCCCTTCGGTTTGCAGGCCAACAAGTTGTCCAGAGCGGCAGGGGGAACGGGAACGGTGGGGTATGGAAA
GCCCCCGTTGCGAGTATTAACAAGATCATCAACAGACCGGATATCGATGTGAAACGATACATCGAGGCGGCCAAGAAGGCGGCCGGAAAGTAGTAGCTCG
GATGCGGAGAGAGAGTCTGCGACTATCTTCTTTCACGTGTGAAAAGTGGTGCATTTCAGGACAAAGCAGCACTTAGGATACGAGAACATTCTGGACAACG
ATCTAGAAATGCTAAAACAAAATCGAAGCCTGACCGGGAGGGAATGCTCGCCTCGTTGAAGTAACCATCCATAATTCATGATCCATGCGACTTTGCATAC
GGAAAAAATTTCCCGGGGTATACATTTCGAGTCCTCGAAGCGCAGCGTCCACTTCTTGGATCTGGGCTTGCACCCGCGTGCCACGAACCCGACGATCGTT
GAGGCCACGACGGCAGCCAAACGCTCGACTAAGCGTACAGCTTCCCACGGAGTGCTGCACGTTCCCTTGAGCGTCTCGTGGAGAAGCACCAGCGTCAGCG
CTCCAGTCGCACCGCCGAAAAGCAGTCGAACTATGAGGCGCCGGCGCTCGGGGTCGGCCCACGCTCGCCGCGATCGAGCTCGACAGCTTGGTAATGTATC
TACTGGGCGCGTTGCGTTGGCTGCTGCTACAGTTGGTCGCGATTCTCCACAGCTTTTTCAACTTGACTTGACCAGCCACCGGTGGGATGGCCCCAAGCAC
CACGACGAGTCGCGCGTAGCGAGTTGCTCGAGTGACGCTAGCGACGACGGCGTTGCAGCGGCAGTGGTAATGGCAATGGCTTGGGTGTCGCTCGAGTTGT
GATGGAGAGCACTGCGGCCTCTTGTTCGTAAGCTTCCTCACGACGAGGCAACGGGCCACGAACAATCACCGCCGCTGCTTGTTCGCAATCTCAACTGCCT
GCAGACAGACACGGCAACGACGAACAAGAGTCGAAGGCGTTCAGGAATGCACGAAAATCTATATTGCTCGGTCGCGGAGCCACTTTCACGCTTAGTCTAG
TTGCGTCGTCTCTTCTTGCGGCCCGTGTTGGCGCGCGCGGCCTGGATGTTGCAGGCCACGCGGTGGGTGTACTGCACCACGGCCTCGTCCGCCATGATCT
CGTCCGTGAAGGTTTTGCGGCGCTGCTTCTTGGTGAGACGCGCCGAGTGGAACTCGTGCGCGCCCTCGACCACCACGCCCATCTGGAAGTGCTTGGGCAG
CGCGCGCGAGTGGTCCGAGCTCTTGTAGAACTTCTTCGGGTCCAGGTAGTTACGCATGCGCAGCAGCTGGAAGTCCCGGCGCGCGTCGTCCGTCATCTCG
TCCGACTCGAAGTTGAACCACCTGCGACCCGCCGACTTCTTGTGTTGTGACTCGGTGCGCTGTCGCTCCGAGTGCGCGATCGCCTTCTGGCCAGCCGCCA
GCACCTTGGCCTCCTCCGCAGCACGCGCATCAGCACGCAGCGTCGCGGCCGACAAGCGCCTCGAGCCCTCAAAGTTGAAGTACTCCTGGTACTGCGATGC
ACCGCTGTCCAGTTGGTTCGGCACGAGCCGCCGCTTCAACGCGGCAGTCGCAGATGGCTTTGAGGCAGCAGGCGTTGATGACGCAGCGGTGGAGGACGCA
ATGTTCGACTTCGTGGACAAGTTCAAGCCCGACGCAGCCAGGAACGCCTGCAACAAAGCAAAAACACAACGTCAGCTAGAGCCACAAAACAACCTCAAAT
TGCAAGGTGGCAGGGCGTACGTATTGATCCACGTCTTCGTCGTCGTCGTCCTCATCGTCTTCCTCGGTCTTCTCCTCCTCCTTCTCTTCTTCCTCCTCAT
CATCGTCCAGCAGCATAATCTCCTCCTCTTCCTCAGTCTCCTGCTCCTGCGTGGACTGCTCCTTCTCCATGACAATAACATCCTCCTCCACTGAGCGTGC
CTCCTCCTTCTCCTCCTCCGTAGGCTTCTCCTGCTCCTGCTCCTGCTTCTTCTCCACTTCCTGCTCCTCCGACTCCGTCTCCGATCCGATGACGATCACC
TCCTGCTCTTCCTTCCCCTCCTCCTCCTGCTGCTGCTGCTGCACGGCGCTGTCGTCCTCGTCCGAGGGCTCGAGCGGGATCTCCTGCGCCGTCTCCTGCG
CCTTCTTGGCGCGGCCGCGCGGCGACGGCGTGCGTCTGGACTTGCGCGTGCTGGGGCTGCGTCCGGCGGGCGAGTTCATGGGCGACGGCGACGGCGACGG
GCTCGCGCCGGCGGCCGCGGCCTTGGCCTGCAGGCGGCGCGACGTCCTCCGGGTCTCGACCATCTTCGACTTGTGTGACTGTTGATAATGACTGGCGAAC
GAGCCATTCGGGGGCGGCAGTCAGGTTCGGTGTCGTATTTGGTACAGTCGGTGGTGCTTCTGAAACAACTTATTGTGGGACAGAGACTGGCACGGGATCA
ATTAAACATGGGGCGCAAGGCCGTCAAGACGCTGGCCAAGAAGGCTCCGGTGCGAGACCTCGGGACTGCGTTGTGGTTAATGCATACTGCGCATGAGTCG
CTGATGGTTGTGTGTGTGAATTGTTGCGGGCAGAAAGTCGTTTTTGAAGCGGCTACGGGCAAGAAGCTGGATGTCGTCGCTGCCAAGGCCCAGCGGGGGA
AGATCAAGGCCAACAACAAGAGGAAGAAGGGCTCGTCCTACGTCCGGGACGACGACGCCATCAAGCTCATGAGGCGGCAGCTGGCCGACGTTGGCTGCAA
ACTGCACGTAGGACGGTAACCCACTGTTGCTTGTTGCACTGGAGCCCAAGGCTCCAAGATTCGGGAGCTGACGAGTCCAGCATGGCATGGCGTTTGTGTG
TACGTGTATGGTTGTGACTCTGCTGCAGGAGGTGGAGGCTGACGGCAATTGCCTCTTCCGGTACGTCCGTACAGTTATGTGGTATTGCTCTGAATGAGGC
AACTCACGGACTGTAGATGGTACTGCTCGTCGCTTCGTGGCGCAGTGCTCTAGCCGACCAGCTCTATGGAGACCAGCACC