Description :
From Genome Similarity Track
Location :
contig_118:1358- 5774
Transcript NameFunction/comments
g11300.t1hypothetical protein PHYSODRAFT_295452

Sequence
4416 bases(100 bases per row)
CGCTTAGGCCCCCAGCGGCTCGGCCTCGACCTCTTCCTCGCTCTTGACGTCGCCCTTGGCCGCGAGCTGGGACGGCTCGTGGTCGTCGCACTGCGCGACC
CACTTGCTCTTGACCGGCATGATGTGGCAGTTGATGCGCATGACCTTCAGCCCCTTCGTGACCTCCAGGTCCACCTGCGTCCAGTTGTTGCGCTGGTCGG
GCATGGTGCAGATGTGGCCCACCTTGGGCTGGCCGCAGCGGCCGCACTTGTACAGCTTCCGGTTCGCGTCGTCGAGAGCCATCTTCTTGCTGGCCGATGA
GGAGGCAGAGGTGCTCACACTGCGACGCGGCGGCGAGCGGCCCGGATTGAGGTCTGCGGGACTCGGCTCCTCCGGAACCGAGAGGAAGCCTAGATTCATC
TGGGACATATCCACCGATAGCCCCGACGAGCGGTTCGGACCGCGCCTGCGAGCGGCTGCGCGGGGCGGCAAGTTGCTTCCTAACGACGAGCGTCGGCCGT
GCAGCGAGTGCACCGGCCCCGCTGGCAATCTGAGGCGGCACCTGGAACTGGAACTGCTGCATGTTGGGCTGTGGTGGCGCCGGGAACATGGTCGGGTCCT
GGAAGCTGGCGAACGGGTTGGGGTACCCTTGGTTCGGGTTCATGTTCTGCTGCTGAGCCGACTGCATCTGTTGCTCCTTGGTTTGCTGCGCCAAAATGCG
GAACTGGTCCAGATTGTGAAGCAGGTCCACAGGGTTCGAGTGGTGCCTCGAGTGGTGGTTCACGGGGCGCTTCCGCTTCATCTTGAGCTCATTTACTCCC
TCTTGGATGCGCTGCGAGCGGTAGGCGACGGGGGACGCGCCCCCATTAGTTCCGCCATTGTCGTCCGTCGTCGCTGCGTTCACCACCGGTACCTGTTGCT
GCTGCTGGTCGGGGTTTAGCTCCGACCACGATAGTTCCTTGAGGAACTCATCCATTTCTTGGAACGACTCTCCCTGAGGCGTCGCGGAACCCGTGAACGG
CATGGGGTTGGTGATCGGGGATTCCCCATGGACAGGTGCAAAAGGCATCATGTGTTGTTGGGGAAAGCCCATACCGTTGGGCCCCATGACAGGCGTGGAG
ATGACGCTGGGAGCCATGTTGGCCATGCCGAAGGCCTGCAGCACGTCCGGATTGGAACGCACGCGCTTGTGTTTGTGCTGCGGCGCCACGCGGTAGTTGG
CCCCCACGGCCGTCGAACCGTTCGGGTTGAAGGAGAAGGAGAGTGGCGTGAGCAGGTCGTCGCTCTCGGCCTTGGGCGCCATCATGTTGGTGGGCGATGA
GCCGGGCACGTCGCTGTCCAGCAGCATTTGGTCGTCGGGCGCCACGAAGCCGGCGGGCGCGTTCACAGAGCCGTCAGCGGGCGCGTCTCCTCCCTCGAGG
AAGTTGTAGTCGAGCGGCAAGCCGTCGAACAGGTCAGCGTCTGCGCGTCTGCCATGGGGACCGGTTGGGAGAATTCTGCTATAGAGGTCGAAGCTCTTGT
GAGTTCGGTGTGTGCAAATCGAGTTTGGAAGGGACTGGTGCGACAAATTCATGCAGCCTCGGATTGGTCAAAACTCTCTAAACCCTAGCCCTAATCTACC
AGCTGCCGCCTTGATTCAAAATGGCTACATTATGCAAGCGGCGGCGTCGCAACCGCACTGCAACGGCTTGACGTGTTTGCACGCATCACGTTTGCCGCTC
AAGACGCTGTTAACAAACACTTTCTTAATACTTTCTTCATACATATTATCCACGTGGGGAGGACGCGCGGTTACCCCTCGCTACAGGCTACAGAGTGTGC
GGGAACGCCATGGTCGGCGTGCCGCCGCCGAAGCTCGAGACGCCCATCTCGTACGTCACGGTCTCCGCCGGATGGTGCTCCACCGTCTGATAAAAGGTTG
GGTCCAACGCGCCAGCCCGTGCAGGATCTTGCAACAACGCCTGCAACAACGCACGCGATCGGCCGAACGCAGTCAGCAACCAATTTTCAAGCCCAGATCG
CCCTCAAGCCGGCGCCGCGCCAACGAAGCGATGCCATCCGTGTCAACTCCAGCAACAAACGTTCGACGCGGCGGCGGCCTTCTTAGAAAAGAAATTCACT
CACCTGCAGACTCAGCGGGCTCAGCTGCGACGGATCCTGTCGGGTACGGGTCCCACATGCCCGCGCCGTTTGCGCCAGGCTGCTGAGACTGCTGGCCTTG
CTGATGCTGCTGCTGTTGCTGCTGGTTGTCGCCTATCCGGGACATAGCGTCAATCTCACCGTTCGCGGCGGGGACGGCGGCCGGGAGCCAGGCCTCGCTC
CCATTCTGCTGCTGGTCGGTCTGATGAACAGGAGACGCGCTTTGGCTTCCAGTGGACGTTTGGCGCTCGTAGTATCGTGGGTCATAACCATTGTTGGTCG
CGTACTCCTGACCCTCATACTGCTGGGGTGGGGCGTAAGGCTGCTGAGCGTAGGCAGCGGCGGCATACAAATTCGGGTCGCCGCTTGGAGAATGGCCCAT
TAGCATGCCTCGGTTCTGTTGGTACGGCTCCGCCTTCAGGTCCTCCGTGAGCATGGCGACGTGGCTAATGTGTTGGCCCTGCTGCATCTGCGCCTGCTGC
TGCAAGAGTTTCTCGTGGAGACGCATTTGCTGCATTTGTTGTTGCTGATCAAGCTGCTGCACTGCTTCGGCGTTATGCGCTTGCAAGTGCTGCTGCTGCT
GCAGAAGTTGCATCTGTCGCTGCCGCATCAACGCCGAGTTGTTGTATCCTATGGCCGCCTGTTGTGCCGCCGCAGCTTGCGCTTGCTGTTGGTTCTTCTT
ATGCTGTGCGTGTGAAGCCGCAGCCTTGCTCGGGTTCTGCTTCAGCGACTTCCACCGGATCTTCACCGAGTCCTCCGTACGACCCTTCAGAAGCTGAGAA
ATCTGCGACCACTTGTTGCCGAGCCGTGCTTGGGCGGTGAGGATCACCGAATCCTCCTCTTCAGTGTAAGGGCCCTTATTAATGGCTGGATCCAGGTGGT
TCTTCCATCGTTCACGGCACTGCTTGGGCGTACGTCCTGGGATACGCTCAGCGATCTGGCCCCAGTTGTTGCAGCCTTGGGTCACCAGATACTCGAGCAC
TTGGTCCTCTTCGAACGACCAGTGCCCCTTCACCAAGCCCGGCTTTAGCACCTTGCGCCAACGCTGAAGGCACTGAGCGTGATTGCGCCCAGGGACCAGC
TCAGCAATAGCCTTCCAGTTCTTTTCGCCGTGGATACGCACGCTCTCACGGAGAGCCGAGTCTTGACCCTTCGTCCAGCGCTTGGTCGTCGGAGCATCCG
GGTCTTCCCCCAGCTCAGTGTTTCCATTTGAGTTTTCTGCGTTCTCTTCATTAGCTGCCACCGGCGTTCCTGCATCGGAGCGGGTGCGCTGCGTGGGCTT
CTGCTCGCCTTGGACAAGCGTGCGGCTACTCTGCGGACGGTCACGCTTTGCTGCAGACACGTCGTCGTCCTGTGTCGAGAATGTCGCACTGTTGTCTCCC
GGGATAAAGCCCTTCTTGTTGATTTCCAACTCGCGCAGGTTCAACTCCGAGTCTGCAATGTGCGAGTTGCTCAGCAGACGTCCCACCTGCGAGATATCTT
CCTTGGAGATCACCACCGATGACGAGGACAACGAGCGTCCAACGACAACACCGTCGGCGTTGGGCATGCCCGCTAGGTGCTGGGCCGTTAGCTTATGCCC
ATCAGCCTCTTTGCTGGAAATTGCACAAAACGTAGAGCAGTTAGCGCAATTAACACAGACAATAGTTGCACTAGGATGTCGTACCCATCGGGGCCCACCA
CGGCATTGAACGAGTGGAACTTGTTGGCGCCGCCGTTGAGCATCTTGACGCGGCTGGCAGCTGCAGAGAGAGAGCAAAACGTTAGCATCAAAATCATGGA
AAGAAAAATGATCTGGCTGAGCGCACCGTTGAGTGCCTGCTTGCGCTTGAGGTGCGACTCCATGTTGTGCTCCTCCTGGGCCTGCACCTCGGCCAGCTTG
GCCTGCTGCACGAGGAACTTTTTGCGTAGATTCAGGATGAACTTCTTCTTGCCCTCGACGGTAGACTCGGCCATGGCTTTGATCACGCGGAACTGCTTCT
CGTCCCGCAGGCGGCCCACGTAGCGGCACAACTCGCCACTCTCGCTCGGGGACAACCCGCTGAGCGACATGAGGAAAAGCCGCGAGGCCTCGGCAGGCAG
CGACTGCAGCAGCTGCGCCAACAAGTCTCCAAAGTTGTCGGTCGCCGCCGATTCCGTGGGCGGCGCCGGCTCCGGCTGGTTGTCGATGGCCGTGTCCGCC
ATGCTTGGGCCGTGTGCGTGTCGTAGAGAAGAGGGGCGGGTGCACGCGCGGGCGAATATTGCCTTTTGTCTGCCAGCGGTCGTTCTCCCCTTGTCGCTGC
GGTTTCCCCTTCCCCT