Description :
From Genome Similarity Track
Location :
Scaffold_1336:1358- 5087
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1336-snap-gene-0.2ATP-binding Cassette (ABC) superfamily

Sequence
3729 bases(100 bases per row)
AGCGATGCCAAGGACGCGAAGGATACCGGCAAGAAGCCCAAGGCGCCGTCCATGCCCTTCTCGCAGCTCTACCGGTACGCGACGCCACTCGACAAGCTCT
TTCTCGGGATCGGCGTCGTGGCTGCGGGTGTCAACGGCGCACTCTTCCCGTGCATGGCACTCGTGTTCGGTAAAGCGATCACAGCGTTCCAGCGGTCGGA
TGGAGGTGTCGACAAGGACGCAATCAACTCAGCGGCGCTGGACTACTTTTTGATCGCGATTGGCATGTTTGTCACGGATTATGTCGCGTACATTTTGTTT
TCCCACACGGCGGAGCGACAAATGAAAGTGTTGCGTGACCAAGCGCTCAAGCACATGCTGTACCTTGATATCAGTTGGTACGATAGCACGGACGCGCTGC
AACTCTCGAGTCGCCTTACCGGTGACACGGTCAAGATCAAGGATGGTATGGGCCAGAAGCTCGGAGACTCGTTCAAGTACGTATGTCAGTTCTTTACGGG
CTACATCATTGGTTTCACACGTGGCTGGGACATGAGTCTCGTCATGGCGTGCGTCATGCCTGTCATGGCCTTGTCGCTTGGATACCTGCTTCGTTTGATG
CGCACGCGTGCCATTTACACGCAAAAGATGTACGCTCAAGCTGGTGCTGTTGCAGAAGAGACGCTTGGTTCCATTCGTACGGTGTCGTCGCTGAACGGTG
AGAAGCGTGCGATTGAAAAGTACAACGCTCGAGCGCTTGTTGCTGAGAAGGAGAACATCCAACTCGCAAAGTACACGTCAGCGGTCTTCGGTTTGTTTAT
GGGCAGTATCTGGGTCATGTACGCTGCTGGCCTGTGGTACGGCGGTTCGAAGGTTTCTGATGCGAAGGCTTCGCCACAAGACGTGTTTCAAGCATTCTTT
GGTGTGCTGATGGGTACAATCTCGCTCGCTCAAATCTCGCCAAACATTGCCGCGGTGGCCGAAGCCCGAGGTGCAGCCGCTGCTTTGTACCAGATTTTGG
ACACTCCGTCGAAGATCGACGCCTCGAAAGACGACGGCATCATTCCGGACACGTGCCTTGGTAAGATTCAAGCTATCGACATCAACTTCACCTACCCAAG
TCGTCCAGATGCGCAAATTCTAAAGAACTACAATGTGAAGATCGAAAGCGGACAAACGGTGGCCTTTGTTGGTGCCAGTGGTGGTGGCAAGAGTACGCTG
ATTGGTTTGCTCGAGCGCTTTTATGATCCATCGAGCGGTACGATCCTGCTGGATGGCCGTGACATCAAGACTCTAAATGTGAGATGGCTTCGTTCGCAGA
TTGGCATGGTGTCGCAGGAGCCAGTTCTCTTTGCCAACACTATCGCGAACAACATTGCCGCGGGAGGTGAAAACATCACTCGCGAACAGGTCATTGCTGC
CGCCAAGCTTGCGAACGCGCACACTTTCATCATGTCACTCCCCGAAAACTACGACACGTTGGTCGGTGAGAAGGGAGTTTCCCTCTCAGGTGGCCAGAAA
CAGCGTGTTGCGATTGCCCGCGCTATTGTTCGTGAACCGAAGATCTTGGTGCTTGACGAAGCAACCAGTGCTCTGGATGCTGAAAGTGAACGTGTGGTGC
AAGCCGCTTTGAACGATTTGATGGACAAGACCCAGATGACGACGTTGGTGATTGCTCACCGTTTGAGCACGGTGCGTCGTGCTGACAAGATCGTTGTGCT
GGCTGGAGGTGCTGTCGTCGAGGAAGGTCCTCACGACAGCCTNNNNNNNNNNNNNNNCCAGATTGAGGACGGTGTGTACCGCAATTTGTACACTATTCAA
GAAGAAAAGGCCCAGGAAGAAGCTGAAGCTGCAGCAGCGGAGTTGGCAAATGCTCGTGACGAACCGCAAGTGAGCGAGATGACGCGCAAGGCGAGCATGC
GATCTGAAAAGAGCGACAGAGTCGGCGATGTCTCTATGGCCAACGAGATTGATACGAAGTCTACGCGTTTCACCATCCTTGATGCAATGGCGTTCAGCCG
TCCAGAGCGAAAGTTTTTCGTCGTCGGCATGTTTGCTGCGGCTGTCAACGGTTTTGCGCTGCCTGGATCGGCTATTTTGATCAGTCAATTGGTTGCGTCA
ATGACCACGAAGTATGCCAAATTTGAGAGCTCAGGTGATCGCTCGTATCTCCATTCGCTGTCCGATGATGTGACCCTCTATGGTCTCTGCTACGTTGGCG
GTGCTATCGTCCTGTTCACGTTTACTACGATCCAGAACTTCTCATTCAAGTACATGGCTGAGAAACTTACGTCTCGATTGCGCGATGTGCATTTCACCGC
TCTCTGTCGACAAAACATTGGGTTCTTCGACGAGAAGAAGAATGCGACGGGTGCGTTGACTGCTGATCTCTCGACGAACGCCACGAAGGTTGCCCTCCTT
TCGGGTGATTCGCAGGGTAGAGTTGTTCAAGCCGCGTTCACGTTCTTCGCTGCCTTAGTCATTTCGTTTGCGACGGGTAGTTGGTTGCTGACTTTGATCA
TGCTGGCTGTTTTCCCACTCTTGCTGATGGGCCAAATCTTCCGAATGAAGCAAATGCGCGGTTCTGGAGGTTTGTCGGATGAGCTTTCGGATGTTGGTGC
GCACGCCTCCGAAGCTCTCAGCAACATTCGAACTGTCGTGTCTTTGAATTTAGAAAAGTCGATCTCGGCCAAGTTTTCGGAATTGCTTGAAGCTCCATTG
AAGCAAGGCCGTCGCGAAGCGCAGATCAATGGCCTCGCTCTCGGTTTCAGCTCGTTCATTGTCTTTGCTACGTACGCTTTGGTGTTCTGGTACGGTGGTG
TGCTTGTGGACAAAGGCGATATCAACTTCAAGGAGCTGATGCGTACGTTGATGGCTATCATGATGTCTGCTCAAGGTGTTGGTAATGCTGCCTCATTCCT
TGGCGAATCGGAAAACGCAATCAAATCTGGCAAGGCTATTGTTGCGTTGCGTGACCGCGAACTACCAATCGATTCTTTCGACGAAGGTGGCTTGAAGCCA
GCGAAGGTGGAGGGTAAGATCGAGTTCAAGAACATCACGTTCCGATACCCAACGCGTCCAGAGATCACTGTGCTCAAGAATTACAACCTTACGGTTGAAG
CTGGCCAGACGGTTGCGTTCTGCGGTCCGTCTGGTGGTGGCAAGAGTACATGCATTGCTATGATCGAGCGATTTTACGACCCAGTGCGTGGCGAAGTGCT
TCTCGATGGCAACAACCTGAAGGACTTGAATTTGAACTGGCTTCGCAGTCAGATCGGTTTGGTCGGCCAGGAGCCAACGCTTTTCATTGGCACCATCGCT
GAGAATATCGCGTACGGGATCGAAACCACTCAGGAAGAGATTGAAGCCGCCGCGAAGATGGCGAACGCTCACGACTTCATCACTCGCTTCCCTGATGGCT
ACGAGACCCAGGTCGGTATGAAGGGCGAACAATTGTCTGGTGGCCAGAAGCAGCGTATCGCGATTGCTCGGGCTATTCTCAAGAACCCAGAGATCTTGCT
GTTGGACGAAGCCACGAGTGCGTTGGACTCGGAAAGTGAAAAGATCGTGCAAGAAGCTTTGGACAAGGTTGTCGCGATCAAGCGCCGCACCACCATCATT
ATTGCACATCGCTTGTCGACGATCCGCAAGGCGGACAAGATCTGCGTCGTGAGCGGTGGTAAGATCGCCGAAGAAGGCACGCACTCGGAGTTGATTGCTC
GCAACGGGTTGTACGCTCGCCTTGTGGAG