Description :
From Genome Similarity Track
Location :
Scaffold_19:1358- 4132
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_19-fgenesh-gene-0.8Conserved gene of unknown function

Sequence
2774 bases(100 bases per row)
GGCACGCGCCACGGCGTGATGCTCCACTGGACACTGGGAAGGTTTAGGAACTTGCGGACGTTCGGCTCGGCCACCATGGTGACCTCTTCGTCGAGCACAC
CAAAGAACCGCATCTGCAGCAGTTTCTCGAGGAAGCGTTGCAGGTGTGCAGCGCGGCGTTCAAGGTATCCAATCGAGAGATACCGAAAGAGCGTCTTGGT
GGGGAAATGGTTCCGCAACGAGAGCATGCGTAACTTCGCTTCGATGCGATTCACCAGAGAATCAAACTCGGAAAATCGACGGTCCACGGTAGTAATTTCT
CGTCGACCACTCAATTCGAAGATCACGCAAATCGTATACTTGGCTCGCGCGTCGGAGATCGTCACGCTCGTGATTTCGACTGTGAAGGCACCTGGCGCGG
AGCGTTCTTGGTTCCAACGACCTGGCTTGATGAAGCGGATACACTTACCATCAGACCGGTTGTCTTCATGAGGCGTATTGGGTGACTGATGATGGTGTGG
CGAACGGAACCCCGATGCCCGAAAGTCGAAGCCGCTATCACTGAGGCGACGACTCGATATCGACTGCATCAATTTCATACGACGCGATGACGAGTCGTCA
CGACCTGTAAGGGAGAACGACTTGGAGTGCGTACCAGCTCGGTCCATGGCGTCAAACCAGGCGCTTGGGAGTAATGTCCGATCGCTAGCGGCTCGGTGCT
CGAGTCGTGCGCCACAGGAACTTGTGGACACCATGCCAGGGTCTCCGAACCCCAGTGAGAGATCGAAAAACTCGCGCACAATGAGATTTTCCGCGACGGG
TTCGGTTAACACCAAGAGACGATTGTACCCGATCTCGGTGATGCTGAGCACATAGCTTAGAAACGCGGTGACGGCCTCGGCGTACTCCTCGATCTGTGGC
TGCGATGACGAGAGCACCGACAGCGTGAGCTTCGGCAATCTGTCCATGAGCCGGTGGCCGAGGTACTTGAGTGCCATGGTCTCGGAAAACTTGACCAACT
CGCTTTCGCTCCGCTCGATAATCTTGACGAAGGATTTTCGCTTTGTAGTCTCTGTCGTGGGGGCGTCTTTCAGTGGTCGAATGGAGCAGCACACGACCGC
GAGGCGCAGCGCGGTGCTGCCGCCACTTTGATCACACGCAGCCTCCGCTCGCACGGTGAAGTCCCCAGGAGACGCGAACATGGGCGACCACGTCTGCGGG
TCACAAAAGAACTGATATTGGCCGACATGGAGATCGGGCATTGGGATCTCTTCACCGTCGACGCTAGTTGTTGTGAGCGTATCTTTCCGCTTGGTTGTCG
TGCTCTCTCGCCCGACGGACGCCCAGAGTGACGGAAAATCGGAGCGGCTCGCGGTCTTGAGACGCGTGGCCATGCTGTCGTAACGGCTAAGCGATGGATC
CACCCGCCGAGGTGGTGCGGGGGACTCCCCTTCATCCACGCGGTCGCTTCGAGAGCTTGCCCAGGAATCGCCGCCGCTGAAGCCACTACCACGCCTTGAG
TCGAACGGGGTCACGACTGCAGCCGCCGCTTGTCGAGAGCGTTCGCTGTCCTGGCCCTCGTTACGTTCGACTTCATCGGGACCCAAGCTGCTGCGGCCGC
ACGTGAGGATGAACATCCTGGATGGGCTTGGAGAGGAGACGGAACACGCCGCGAAGGTTTCCAGCGCGGATCCGGCAGTCCAAAGCGCGTCGGTGTCCGT
TTCGGACGGGTGAACGGAGAGGCAGCGGCTTCGACCTGCGACTCGCTCGCCTTCCTCCGTGCCGCGACAAATTTAGATGATCGTTGGCGTTAGTTTTCTT
TCTCGTGGCAGTTGGACTTTGGAATGGGAAACCCCGCGTCCTTTCGCGCTGGAGGGGGTTAGCACTCGACGCAGAGCGTATCCGTTTCGACTGTGGGATC
TCTTGCAGTGCGCACGCCCACTGTGAAGATGAGATCTTATGACGTACACGCTGGATCAGAAGAGAGAGAGAGAGAGAGAAAGCGACGCCAGTGAAATCGA
GTGGCTACTGCCGACGCGTGGTTGAAGTCGGCAATTGCCGCAAAAGGAAGAAACCCTTCGTGTCGTACTTTTCGGGATCTAGAAGGTACTCACTGACTGC
TCTGCGACGCGCGCACTCGTCAACCGACTGATGGGGCTCAACTCAGAAAACCGGTATTACTATAATTTGATCTTGTTGACACGCTTTTGGATCAGATGTG
TTGCGGAATTGGGGGACTTGAGCTCGCGCGCGACGAAGAAGATGGCAACATCGGCCTACAGTATTCCCTTCCTGCCTGAAGGAAGATACGACCGAACCAT
CACAACCATCACATTTCCTTCTTGTGGAGAGAAGGCGAGCGCTGCGTCGTCGAGGTACCGTAGATGCCGGCCAACCACCCTCGCCCGTTGCTGCTGAAGT
TGGGTTCACTCCTTCCTTCACGCCAGTTGGGACCTCCATCTTGCAATCGACTTCAAGTACCAATCGACTCTGATTTGGGTCTGTTGGCCACAGCAACCTC
CGTGACGGAGTCCGTCGTGGTCTGTTAATAGCACTGGACGCTGAAGGCCACGGCGGTTTCTGGAACATTTGGAGCTACAGTAGCGATCTCAGGGTCACAC
TTCTCGGTGGCTATCTGTGGAGTACATCCAATCCATTCTGTGACGATCCCAAACCTGATATTAATACAGCTTCCCGCGGAGGTGCTGCCGTTTCCGCCTC
CTGCAGGAGTTTCACTTTGTGCTCCATAAACTATGTAGACTCGTGGTCGCATCGCCATGAGCCGCTCTGCTGGA