Description :
From Genome Similarity Track
Location :
Scaffold_2051:1358- 2508
Transcript NameFunction/comments
Phypl_g14606Avr4-associated TDF-like protein

Sequence
1150 bases(100 bases per row)
ACTCGCTCCTCATTCTTCAACTTGCCGGCGACCAACCACCACAACGACCAAGTCTCCAGCACAGCTCAACCAATAGCACAGCAAACTATGAAGctcttcg
ctgctgcctgctggGCGCTCCTCGCGTCCACCGCCCTCGCCGTCCAGGAAGAGACCAAGACCATCGCCGAGCTCTacgccgacgccatcgccgaAGGAGG
CGACCTCGTCATGTACCACGGCGGAGACTTCTCGTCGCAGCAGGacacgctgcacgaggccTTCAATTCCGCCTTCCCGGAAATCAACTTCACGCTCATC
GTCGACTATAGCAAGTACCACAACGTGCGCATCGACAACCAGCTCGAGACCGACACGCTCGTGCCCGacctcgtggcgctgcagacaCTGCAGGACTTCC
CTCGCTGGGCGCAGGAGGGAaagctgctcgagtacaAGGCCGCCAACTTCTCGCAGGTCTACGACGGCTTCCGGGACCAACGCGGCGCCTACATGGCCTA
CATGATGTTCACCTTCAGCTTCCTGTACGacgagacggcgctggacggccTCGCAGCGCCCAAGTCGCCGGCCGACCTCGTGGACGCGCAGTGGGCAGGC
AAGATTGCTTCGTCGCACCcgaccgacgacgacgccgtgctcttCCTCTACAAGCGCTATGTGGAGAAGTACGGCTGGAACTGGGTCGAGGACTTCTCCA
ACCAGAACGTCACGTTCCGCCGCGGCTCCAACACGGCCAGCGACCTCGTCACGGCCAAGGACAAAGTCATCGGCGTCGGCACCTACTCGGTGGGCACGCC
CAACGTCACCTTCGTCacggacggcggcaacgagtACTTGTCCTGGGGCCAGCGCATCGCCATCCTCAACAAGGCCAAGCACCCTGCGGCCgccaagctc
ttcatgaaCTGGGCCATCtcggaggaggcgcagaagacgGTCGTGGCCGAGAACGTGCGTGTGGACCTGACGCCCAACGGCGGCTCGAGCCACCCGTGGG
AGATCTGCAAGGCGaccgtggacgagttccCGAAGTTCATGGCGGACCGTGCGGATGTGGAGGAGTGGCGCCAAACGTTCTCGCTCTACTTCGGTGAGGT
TCAGGGCGACCCGACGCCGGGTTTCCTGGGCGTGCACCCCGGTCTGTAGG