Description :
From Genome Similarity Track
Location :
contig_50:13570- 17624
Transcript NameFunction/comments
g9890.t1hypothetical protein

Sequence
4054 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGGTCCCGCCTCACTATCC
CTCGTGAGACTGCATCAAACCAAATCGGTTGTGATTCACGCGATCCCGTAGGAACTCATACAATAACGCACCACAGTTGAGATCCGCTTCGTCGATCCGC
TGGGCTCCTCATATCCACGCCAGTGTACTAGGAACTCACGATAGATCCGTCCATATCTCGTACGCTAGCCGGATCTCAGATCCGTGATCTTCTCGACTTT
GTATTCATCGGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCGCAACCAACTGAACGAGCGGGCGAT
CTGGGAACTCCTTCACCAACTTCAACTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGACAGTTTCGAGCTTGACCGCGTACTCATGGAT
TTTCTCTGCCACTCGAAATGGCCCGCGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGCGAGATCCAGCTTCTATCGGGTGA
GGTCGAACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCGTATAATAACGCTGGATCC
GGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGAGTACTACCCACCGGGATCCTGGCCTCTAATGTAGATCTAGGATCCCACCCATGTACCAAATA
GAAAGGCGTATCACCTCGGATCCGATCCTGGGCTGTGTTAAGGGCAAACGTAAGTCGCTCGGCGTACTCGTCCCAATCCTGTTGATCCAGATCATGGACA
TGCATCTTGAGTGCGCGCGTGATCGTCTGAACCATGCGCGCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCTCTGACGCTGTCCTAGGA
TCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGCTCCCGATCGTGCCGAATTACCTCGCTAGCGCCAAATCGGCGGAACACACATTCTTCGTA
GGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGTGTTGCCTCTA
TGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTTGGCCGAC
CTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGATCCGCTGGTAAGTGCG
GCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCGCATCGCGAGATCTCGA
TCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGCGTAATCCGTCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGCTTCTTCCTGGGCCA
ACGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGAGCTCCCTCACCAA
TTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAATCGGACCACGGATTCTCGGACTGTGACGGTTAGAAT
CTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCATCTCGCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGGA
ACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAAACCTGGGGCCTTA
CAATCAATTTCCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGGTCGAAACACAACAAG
AGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATCTGGTAGTTTCCACAGGATCGCGCTGTA
CGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACGGGAGCTTGGATCTGCCGT
CGGGGTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTCCACATCGGACTAGGTGTAATACTGGCAGCCATCGCCCCTAGGATTTCGTCTTCACCTTTGG
TGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAACAACCATGCTAACGTCGA
ATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACACTTCCTTCTCGACCACATTATAA
TTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCGGCGGAAATAGCCCATTCGCTAG
CGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGCAAACGACCTATATGCTCT
GACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGACGAACTGTGATCCAGG
ATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAGTCCTCGATAAATCGGC
TGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCGAT
GCCATCGTCGGACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCACACGCTTCGA
GCAGATTCTCCACCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCCTAACACTGACGGACGACCTGGA
TCTTCCGGTTCTCCAGCCTCAAAGATCTGGAGCAAGTCCTGGCTCCTCAGGGGGGGGATCCGTGTAAACCCATATAACGCATTATCCAGAAGCCGCTGAT
AGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGCGCGAGCTCGGTCCGTCAT
AGGTACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATCAGAGGCATAGGGTAGATC
ATTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTTGATGATCACCACGATCGGTGATGCCCACGGCG
ATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTCCGCACCCGTTGCACGAT
CGGCTTAGCACCTCCTACATCGATATCACATACGACTCCTCGAGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAACAAGTGTCGCTTCCGCCAGATG
ATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCGCTCGTCATAGCCGTGATCTCTG
GCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGT