Description :
From Genome Similarity Track
Location :
Scaffold_1823:1357- 2378
Transcript NameFunction/comments
Phypl_g14212hypothetical protein

Sequence
1021 bases(100 bases per row)
AGTCTTACATATCACTCACACGGTCGAAACCCATTTCCAAGCTGCAAGGCTCATGCGCTGCGGCTCATTGCTCCTACGGAGCAACAGGCAGTTTGCCCAC
AACCTCAAGGGGTCCACATCGACCCAGAATCATTCCCCGTAAGGTAAACTCAAGTGGCACCTCGGCGACCACTCGGTCCGAGTCTAAGActgcgaagccg
aagacTAAACGAGCTAAGCCTCACGGCAAAGCTCAGGCACTGGATGATGCCGTTGCCGACGACGCTTGCAGTGCCTGTCGCGACCGCCACGACGAAGGAC
TCAAACCCTCGTCGGTGTCGCTCGCCTTCATTGCCTCTGGACACTCGTGAGAACCCACGGTTCATCCACAGGACCAGAAGCCGGTCTCCATCGTGCTCAG
AGGCGGGGTCGACTCACCTTGTCCACTCGGATGAGGACAGTGAGGACCAAAACGACAATATGTCTACGGCAGCGCCTGATGCGCCACCTGAGGGTGGCAC
CCCTCCTTCCGATTTTGCGAAAGAGCAGGCCCAAAGCCTCACAGATGGTGCTGCGATTAGCCACTTCACACTGGAAGAGGGCAAGCCGCGGGCACAGGCT
GTTAAGGCCAAGGCCGGTGAGTCCAAACATGCACGTGCTTCTAagcgtgctgcttctcggtCTCCTATCAAAGATGCCTCCGACGAATACGAGCTCAGTG
GCCAGACGCTGTAACGCAATGGCGAGCCCAAGGACTCTCCGCTCTTCGAGCTATCTGGCTCCGAAGAGGAAGGGGTTGTGTTCAAGGCCGGTCTTCCGGA
GACTACGTCTGTCTCCCATGGGCAGCGGGCGAATTCCAGCCCTCGACTGCTCTTGCGTCTGGGCATTACGTAAAGTACTTCCCGCTTGATACCAGCTCAG
GGGTAGATGATTACCGGGAGCAACTTGTTACTCCCAGGAAGTTCATCGGTGGCTATACCTCTTCGGGCGCGTGTGAATGCGTCCTAGCGGAACAGGTGTC
CTTCTTCCAGGACAACCTGTA