Description :
From Genome Similarity Track
Location :
Scaffold_1:135682- 138629
Transcript NameFunction/comments
Phyta_totarag42hypothetical protein PHYSODRAFT_474224
Phyta_totarag43hypothetical protein PHYSODRAFT_553621

Sequence
2947 bases(100 bases per row)
TATACTTTGGCGCACCAATGAACGGATCACTCTTGTGAATACTGTCGTATTCGATAGCCTTGCGCAGTTCATACTGATCGCGTTTCGAAAGCTTCTCTGC
AGGTCTTGCCAGAGAATTCTACCATCAAACAACACACGGATTTTCATAAGTCAGCTGCACATAAGACTCCGTAGCACGGTAAGAAACGTCACACACCTTG
ATCTCCACCTGGCTCTTGCCCTTGGCACGAAGGATGACTCGCATGAGCGACACTGGCGGATAGTTGTGTACCGTCGACAGCTCGATGAGGCTGCGGCCGC
TGTCATATTCCTTACAGATAGTGGCTCTGTCACGGCGGACACGATGCGTATTGACCAGCAACGACATGCGCAGCAGTTGCTTGCGCAAGTTGATGGTCAT
GTTGGTCGTAATAGGCAGCATCTGCAGGAGCTCATCGATATGGTTCACTTGCTTTCGCTTCAGCCGTCGAAACGTTTCTTGCTGCAGGATCAGCCCTGCT
GCTTGggtctccagcacctgcggGATCGGGGTCACAGGCCATTCTTGTTCGATCGGCGTGAGGTCACCGAACTTATCCCGTGCGTTTTTGatgtccttct
tcgtcagtgcCATGTAACTCGGTCCGTTGCTGTACACAGACGACTGCATGGACGAGAATACCGATGACATCGCAAAGCAAGGATCCAGCCCCACCGCACG
CACTCCTTCCATCACTGTCAATGCACGGTCCTTGCGTCCGGATTCGAGTGACGTGAGCGACATGATTTCCGGCTCAACTTCCGAGAGACGCATCTCCATC
AGGATGTCGAAAAATGCATCGGACCGCCAGACAATCGACGCACGAAGCAGCCAGTGCATGTACGTGTGCACCGAAATAGGGCGCAGCaggcgaagctgct
tcagcaccttAATGGCACCGTCCAGATACTCCTGGCGGTAACAGATGTCCAAGAAGCGGTTGTAGTCAGCCAGATCCAGCTTCACTCCTGCTTGTTCCAT
GAGATCCCACAGTTCAATcacttcaacagcagccgAAGCCTCGTCACACGCAGTAAACAGTGTCCGCAATGTAGACTCATCGACCTTGCGTCCTTGATTG
AGCATATCCTGGACGATGCGGATGCCCTCGGCTGGTTTCTTCGCCTCGCAACACGCCAACACTCCTGGCGTCAGGAAGTTCTCGTCCAAGTACGGGTTGC
CAAAGTTGCGGTACAAATCAAACAGCTTGTGTGCATTGTCAAACGACACACGACGGAGCTTGGTAATCAACGACGCTATCTCCTTCTCACTAGGCAGAGT
CTTCTGCAATGCTGAAATCTCCTGCAAAGTCATCGTAATTTTCTCTGTCTTGAGGTTCTTCAACGGCATCGGCTCTTTCGCTGGCACCACGGCAGTCTCC
GCCGACCCGACGATTCCGTTCGCTTTGTCCCCAGGCGGTGCATTGCTTCgtttgttcttcttcgcacCAGACGTaaccacagcaacagctgcagtAGTCT
TAGCGTCTCCTTCAATCGCTCTTGCCAGCATCTCTTCCTCAATCTGCTTCTGGGACATGGGcttccgctgcttctgcttgagcttcttcttcggcgtcga
AGTCTCCGCatcctcctccaccttcgcagcaacaacagaatTTGCAGTTGTCGATGCTTTCTTCTTAGCCGCTTTACTCTTGCGGCGCTTGTTGGAAGCG
ACGGGTTTGTTGTGGTTTGCAGCATCGgccgctggagctgaagtcgctgcttctgcctGCGTGGAGGCAAAGCGCAAGGCCAGAGGCTGACGAGACACGC
TGAGAGTGTTTCCAGGTATATGAATCGGAGCGTGGGTAGCCGAGGCCAGTCCTAGACGACGCACGCCCACGCGAGCGGCGTAGCGCGATGGCCTCAGAAG
CATCAGGTTCGGGTGGTCAGGATGGATGGGCCACTGCTTGGTTGTGGGTCAAATTGTTTGGATGTCGCGTGAAGGTAacgcgcttgcgcttgggGTAAAT
TTAACAATCTTAAACGGAATATCAAATATTAGATTAAATACCCGACTACAAAACTGAGAGTATTAAATAAAACTAGAAATAATATCTGAAAATAGAGGTG
ATCATACTGAAGACGCTTGCGCCCAGTCAAATCGCTTGGTCAAATACAAGCAAGAGACCTGATGGCGGAGGAAGCTGTGACTCCCGACGCCGCGGCATTC
GTGAGCGCCTTGTaccgcaaggtgctgctctCTGTGAAGGCCTCGAACGCGGTTCCGTCCGAAGACGATGGATTCCACTTCCACACGCAGTTCAGCTCCG
ATTTCGCGTCGCGCTCCAAGAGTTCCGGAGCCAAGGCCGAAACGCTCGTGCGGCTGCTGACCAAGCGCCGACGCGCCGACGCGGACGGAGACAACGGCGC
ggaaagcagcgacgaagacagcgacgatcaGCAGGAGCTCTTCGACGGGCCGGAGCCCAATGCGCGCGTCACAGACTACGccgacatgctgctggacgaa
gcgTCCAAGCACCTGGCGCGCTTCGTGCGTGGCGAGACGGAGGCTTCCGCGGACTCTACGCAGCTCGTCCCACTGGAGAACAAGCCGCAGGTCTTtgaga
agaacaagaagaccaaaAAGaacgagaaggaagaagctgcagagaagaagatggcgcgAGGAGCGCAGGACAAGCCGCAGGACAGAttcgacgagaagat
cgacaaCTCGGACACGCCATTTGTGTCGAAACTGCGCGAGAAGGTGCACGCTCGGAatgatggtgctgcagctgctgctacggaggatgaggacgacgag
atggttCGGCGTCATCCGTACTTCCCGGAGATTAAGGGACTCAAGTATGCGCCGTGGCAATTGGAGGCGGCCGAAGAGCCTTATGagatggtggagctgg
acaaggcgTCGTATCTGTGGGTAGACtcggaggagaagctggtgcag