Description :
From Genome Similarity Track
Location :
Scaffold_1:1356466- 1365466
Transcript NameFunction/comments
Phyin_T30-4PITG_00217Putative uncharacterized protein
Phyin_T30-4PITG_00218ATP-binding Cassette (ABC) Superfamily

Sequence
9000 bases(100 bases per row)
AGTACTGTTCACACGTCACAGATTCACAGGTAACCCTAGATGTCCACTTCATCCTCACTGCTGCCCCACTGATACTGTGCATTGGAGAAGTCGGGTGACA
ATACCATGGGAATTTCTGCCGATTGAAAGCCAAAGCTTCCATGGAGGTGAGGTGGCATAGTCTCTGTTCCCGAAGCCAGCAATGGAGGGCTGAACGGCAT
CGGCTGTCCCGGGTTGAAGTAGTATCGCGACGGTGAAGGACTTGATCCAGATGGTAAGAAGTGAGGCGCATTGAACCTCGCATACGCATCGCCACTTCCA
GGCGAGAAATACCGCACGACTTCTTTCGGTGCCGTTCTCCACAGGGTTGCATCACTCCAAGGGAGATTGGCGCATGGGTCTGGCAGCTCACACTGTCGTG
AAAAGTCCCAGCCTAAGAGCGAGGACGTCGACGCATAAACTTGTTGCAGCTGCCACTCCAGTTCTGCATCCTGATGACGTCTTCGTTGCTTTCTCCGCCC
CCACTGCTGGGCGCCTCGATCCCCAGCTTCTCTATTAAACATATCTCCATCCACGCTGCCAATGTCGAAGGCGCTATCTGCATCGCTTTCAACATCTTCC
CACGGCACTCTGACAATGCATTCATCTAATGCTCGCTTTCCTGCGAATGGATTTCGAACCCCCGTGCCTTTGACTGGCACTACGTGCACTTGGGGCTGGA
AAGCCAAGGCATTAGGATTTAGGGTCGACGATGTTTTCAAAGAGACACCCAAATCAGCAGGAAAAGCCTCGTTCTCCTCCACCGTGCCTTCATCGGTTTG
AGCTGTCGATGAATTCGACTGACAGGTACTTTCTAGGTCGATTGAGTCGATTGACTTGTTCTCAGGTGTCAGCTCCCCCGTCATTGCATCGCTATATGGA
GCTACATGTAGTGGTGTCTTTCTCCCTTCCAAGTGCGTGACATCACAATTAGGTGTCATTGGCTCATCGCTGGTGGCTTCGAGAGTTTTGGTCTGCTGCA
TCGCTGTGCTCGTGTGAGCTGTCGACTTTTTCTTCTTTCTTTTCTTTTTTGTTGAGTTCCCTGTTGACGTGCAATGCCCTGCTATATCTTCCAATGACAC
TTCCAGCAGCAGTTGTTCCATTTGCTGTGCCGCCTGTTTCTCCAGATGAATGACGTAGCTTCGGAGAATAAGCTAAGTCAAAGAATACAACAATAACATG
AATACTCGACCGTACACGTACGAATTGAACAAACCGTACCTGCTCCACAAGCATCGCTATGAGGCGCTGGTAGTCTGCCCAAGTGTTGATAGTCTCACTT
TCCGTCACAAAGAGTTTGTTGAAGCTACTCTTCGTCAGCACGTGGGTCGACGTCAAGAACCCTGCTAAAACGTCTCCAACCAGCGTGAACAATCGGTCGG
TGTCCTCTGCAAGCTCCGTTTTCACAGTCAAGAAACCTGCCATATAACACAATAAGTGTGGGTTTAACAAACGGTATAGCAGGTATAGATGGTACAAACC
AGTGCCAATATCCATGAACTCCATCGCTTCAAGAAGCACGTATGTATCCTCCAAAGAGGTGCCTGATGCTGCACGCATTGGTGACTGCGTTGCTGCTTGC
TCTTGCGCTGGTTTTGCACTGGTATTTGCAGTATTTAAAGCTATTGTCGAAGTTGACACAGCGGCCACTTTCTTGCTGGCAGCAGTTGTGTCTGTAGCTG
CTCGATTTGATGCCCTGAGGTGACGCTGCATGAGCCCAACACACAGCAAACTCAGGTTGAGCTTGTACAGTTGTTTCACGAGATCTGCTTCGTCCAAGAA
CAATATCTGCTGTCGCTCACTGACACTGAGTTGGTCCCAGTAGCGGCGAATGCTTGTCGGCACGGCTCTGCCGTCCTCTCCACGAGTCGACGTGAAGGGA
GTCGCCAAGGCCATCCAGATACCTGATCCTGGCCCGTGCGCTTTACCAGAAGGCTTCGCTCTCTTCCGGCCACGGAGTTTAACATTTCCACTGAATTTTC
TCATACGATCTGACGCATTAATGACATTGGGATCGTCGCTAGGCGCCGACGAACGGATGGCCAAGTAGGATTTCCAGATCGGAGCTGCTGACACAGCCGC
AGATACAGTTTAGAATACAACAGTTAACACGGTAGCCAATGTGCAGACAGCTTGCAATTACGCCACGTACCTTCTGCAGCCGACGCGGTCTTCTTAGCAG
AGGAAATGCTGCCTCGAGAGAGCGGCGCCATGACGATTGTCCTTCTTACAATTGATATGCCGCGGCCAAAGAAATGGTTATCGCAATCATTTTCGTGTAG
ATTTTCTTTGTGATTTCATATATTTGCTCTTTCTATTGTGATTTTTGTCACCAATTTCTGTCATTCTCAGACATCACACGACCATGGCCGACATCCAGCA
CAAGCGGGTAGCGCTGAAACTCAAGCAGGCCTGTGAGGAGACGGCAGAGCAGGCTATCGCGGCCACCACCGCAAGCGGTCAGGCGAGTCGTATTCACGGC
AAGAATCGCAAGTTTGGCAGCCGGAAAGAGGCAATGGCAGCCAAGGTTAAACAAAAGAGAAAAAAAGGCTAGCGAGTTCTCTTGCAGTACTGACTGATTG
TCTTTATGTACGTAATTCTCTGCAGATTGCAGCAGCTAAAGCTAAGCGTGAGGCAAAAGAGGTAGCAGACAAGTGAGCAAACATGGCAGCGTGTTGAAAA
CAACAGGGCCCGCTAGCTGGCACTAAGTAAAGCGTCCGTTTTTCCGTTTCACAATTTTTCTGCTTCCCCATTGCTGTATTGTAGTTTACCGAGTCATTGT
GCTCGTGCATCTGAGCTCTCGTGTTGCCATTCGCCCAAGACGGATGAGGTTCCAGAGTGAACGTCGTACACTGCCAGTATTACGAGCTCTTGTGGTCAAG
AACTGGACGGCCAAGCGACGGCATCCGTTCGCGACGTGGAGTGAGATTCTCAATCCGTTGTTATGCATCTTATTATTCGTTGCATTGAAGAGATTCGAAC
CGGACCTGATTGTCCCTGCGGGATGGGCTTCCAGCGACGTTAACAAGTCAGCTCCTGCCTATGGATCCACTTGGAACCTCTACGCTACGACAGACATGGA
GTCCGCTTTGAACGAAGGCCTGAACAGTGCAGGAATTGTCGTCCCAGAGGACTCCAATAGTGCTAGTGGCAGCAACTCGTCGGATGGAACATTCTCTGCT
ACCTCGTTACTAGAAACTCTCAGTACCAGCTTACAGATTCCGAGGTTTTACTACACCGAAACGACGATGCCTGGATTACTGCTGAGTTTATCGCTTCAAG
CTCTCATGGAAGGCGACAACCTCGCCGAACTGGGAGAAGAAGCGCTCATGGATTGCGCTCTCAAGTTTCTGCTGTTTGGCTACACTGGAGCTGAGCGCAC
CACGTATCATGTTCCCAATGCTTGTAAGGGCAAAGTTGTGCCATACAAGATTGCAATCACCCCGGATACACCGTACACACGAGAGTATTTCGCTGCTGTA
TTAGAAACGTGGTATCCACGCATCGCTCTTGCGCCACCCGTGAGAGGTATTTCGCTCTTGACAATTTCAAGCTTCACTGACTCGCACGTGTTTTTCGACA
ATGAATCAGCGTTGGAGACGTACGTGACCAGTAAGGAATACGGCACCGACGTTCAACACCCAAAAATCTACGGAGCTATTGCTTTTGAGGAGTTTCCAGA
CGACATTTCTACTTTTGGTGACTTGGAAGGCTATTCGATTGCCTATTCGCTACGATTTAATTCGACTGGAAGTGTGTCTGCAGTACCAAAGACCAAGAAG
CCGAGACCCAACACCATCTCAAAGTTTGCCCCCGCAGATAACACTATGAAGTATGCAACTCGAGGTTTTATGACGCTGCAGACACTAGTGACTCGCTTTC
TCAACTGCATGCCAATATGGGATACGCAGTCCAAGACCACGAATGGAACATGTCAAGTTGACCAGGCTGTGACGACTTCAAGTGCAGAGAATGACCGTCG
GCTGCTACAGCAACTCGAAAAAGACATGATCCTTGGCACGGCCTTCAAATTACTGAACTCAGTCAAGGATTCGATCACCAGTATGGCGTCGATGACTCTC
TCGAATGTCTCTGTGGATACAATTCCTCCACTGAGTGTGGAAAGACTGCTAGTACCCTTGCGAATAGCACCCCAATCGTACCATGGCGCAGGGGTCTACG
GAACTCCCACCCAAGCCTTTCGGTACGCTCCATTTTTTGACAAGATCGCTGTGGTCTTTCCCATAGGCTTCGTGCTCTCGTATCTGTATCTCGTGTCACG
TGTCATCGTGTCGTTTCTAATGGAGAAAGAAACGAGGTCTCGAGAACTTATGCGGATTCTAGGAGCAAAGGAGACGGAATTGTTTGCTGGTTGGGTGCTT
GCGTACCTTCCCATCCTCCTACTTGGAGCAATGCTGCAAACGTTTGGAGCACATGGTCTGTTGTTTCCCAATTCAGATACAGCGCTGCTGTTCGTTTTCT
TCTTCACCTTTGCTACTAGCAGTTTCAGCTACGGCTTCATGATCAGTAGTCTCTTTTCAAGGGCACGTGCGGGGTCATTGGCGGGTATGGGTCTGTTTTT
CATCATGTTTTTCATATCCTACAGCTTCAGTGACAACACGAGCGAAGCCAGTCGAACATGCGCAGCACTACTTCCACCGATCTCATTGTCACAAGGCATT
GGTGTCATTGCGAAGTTTGAATCCTTTGGGGTGGGAGTGAACCACGATAACGCCAGCGAAGATATTAACAATTTCCGATTTGGAAATGCAGTCGGGATGC
AGATTCTAGACACGGTGCTGTACATTCTATTGGGTAAATATTTCGAGAAAGTAGTGCCACAGGAGTTTGGAGTGGCGGAGAAATGGTATTTCTTCTTGAC
GAAAGGGTACTGGTGTCGGCAAGCCTCGAAACTAGTGTCTGCTGTAGAGATAGGAGACGTACCTGCTACGAATCACGACACTGTGGAAGCTGTTCCTCAA
GAATTGGAGGCGCAAGAAAATATTGGACGCGCAGTGGTCATCACCGGTTTACGAAAGGAGTTTTCAGTTCCTGGTGGTACGAAAATCGCAGTGCATGGAC
TCAATTTGAAGCTGTACGAGGGCCAGATCACCTGTTTGTTGGGGCACAATGGAGCAGGGAAAACGACGGTAATGTCGATGCTTACCGGTATGACACGACC
ATCCAGTGGCAATGCGTGGGTGCGTGGTCATTCTGTCGTGACGGATATGCGTAAAATCCGCCGCTCTCTTGGCTATTGCCCTCAACACAGCGTACTTTAC
CCGGATCTAACGGTGAAGGAGCATCTTACGTTTTATGGATGTCTGAAGGGCATAACGAATGCAAGTGAACTCGCAGCAGAAATCACCAAGAAGATTAACG
AAGTGGGTCTAGCGGAGAAGACTTATGTATGGTCACGCGCACTGTCGGGCGGAATGCAGCGCAAACTGTCGCTCGCAATAGCATTTCTTGGTGATAGTAC
CGTTGTTTTCCTCGACGAACCGACAGCAGGGATGGATCCGTACAGTCGTCGAAGTACGTGGGAGCTTATACAACGCAATCGTACAGGACGGGTGGTGATC
TTGACAACCCATTTCATGGACGAAGCTGATATTCTTGGAGATAGGATCGCTATTATGGCCGAGGGAAAACTGCAATGCGTTGGGTCTTCGATGTTTTTAA
AGAAGAGATTTGGAGTGGGTTATCGACTCAGCTTTGCGCGACAGAGTGACAATGACGTGTCCTCACAGTCGATCGCAGCGTTAGTTCAACAACATGTGCC
TCAGGTAATTACCGCGTCGGATATTGGAACGGAGTTAACCTTTCAACTGCCATTTGAAGCATCTGGTGGCTTCCCGGTGTTATTCCGCGAACTGGAGTCA
CATCAGAGAGAGCTTGGTATTATTTCTTTTGCTATATCGGTCACTACTCTTGAAGAAATCTTTTTAAAAGTGGCTGAAAAGGGAACTGCAGAGGTTCTAG
CTGAAGAAAATCGTGAAGGTCGAGTAGATACGAAAATGGACGGCAAACTGTCGATCACGGTACAACCCCATGAGGCAGCGATGGTCGTGAAAGATGGAAC
CGAGGACGATAGAACCGAATCGCAGCGTTCCCAGGGAGGGATCGGCTCATTTATGAACCAGATGAAGGCTTTGCTTCGCAAGCGAGTGCAATGTGGCAAG
CGCGACTTCAACATGTTATTTTTCAGCACCATTCTTCCGATTGTTGCTATCTTTATCGGGTTATCAGCATTGAAATTCTCCGTAGTCTTACTAAACGACC
CGAAGTTAGAGCTATCCCCAACTGTGCAGTATTCACTTGCTCAGAATACCCCAATCCCGTTCGGCTGTCCTGGAAATCTTGGTCCGTGGGGTGACGGGAG
TACTACGTGGTGTTCTGAGCTGGTTGAACAAAAATACTTTTCGGAAGGAGCTACATACGAACTTGAAATTGACACAACTGTATACGGCGCGATATCTACG
CCTACAGTTTTCGGGGTCACGTATGATTCACCAGCCATTAAATCAAATGATTCAACCGGCTACAACCTTAAACTGGCCGAGTTAATCTTTGCAAAGGGCT
ACGGATATGCCCCCGGGGCCAATACGACCGCGTTACCAACACAGACGGGAATTGATGGGCAGTTTGGTGGCTACCTGCTGTACGCTTCCGAATCTACCAA
GACGTTGAGCTACAACGTTGTGGCAAATGGTTCGTCAACTCATGCCGCACCGACGTACAAGCATATGATTGACAGTGCTATCCACCGGTTTTTGCTGTCC
AAGGCGTCAGGAGGATCGGCATCCAACGTGACAATACGCGTATCGTCACATCCACTTCCTCTTTCTTTCAAGACACGCTCAATCTTCAGCTCATATTTGA
GCTTCCCAGCTGTGATCTTCGTCGTGATCGCCTTCACTTTTATTCCTGCTTCGATGATGCCCTATATTGTCAAGGAGAAGCACTTGGAACAGAACGCCAA
GTACCAACAACTACTCTCCGGAATGTCATTTTCAGCCTACTGGCTGTCGAATTTCATCTTCGACGTGGCTCTATATCTCGTTCCGATGGCAGCAACGCTT
GTGCTTCTTCGATCTTACGGCGTTACTAAGTCATTAAGTAGCGGTGACACTTGTGACTCGTGCACTCAAGACGTGCCAGCCGCCATGGTTACACTCTTTG
TGTTATTTGGAACTGCCATTGCTCCGTGGACATACTTGCTGTCTCATGTTATGGAGAAGCCAAGTGAGTGCTTACTATATACAGTTATGATCAACTTCTT
CCTGGGTCTCCTACTGCTGCTCCTAAGCTTCACGATGAACTCTCTGGACTCGACCCGACCAGCAAATAAAGTTTTGGTTTACATCTGGCGTTGCTCGCCT
CTATTTGCCTTTGGAAACGGGTTTCTCAACGTGTTGTTGGCAGATTTGCTAGCACTGTTCGGCCTTACTAGCTCACCACGTAGTGCGTTTGATGCTGACG
TGGCTGGTACAGACATCTGGTACTTATTGATCGAGTGTCCGGTCTTCCTCTTACTCACCGTGATGATTGATGTCGTTCAAGCTGGAACTGTTCGCTGGCG
TATTGCTCAGGCTGTGGATAAAATCAACAATGCACGCCGCATGTACACGCGTGTACCTTGCACCAGCTCCAAGCTTCACATCCAACAGAAATCCACTGGA
GACAAGGTGGTTGACCGAGAGGACATTGATTCAGATGTGGCTGCAGAGGCTCGACGTGTACAGGAGAGCTTTAACTCGTTTGCTACCAACTCTGAGGTTG
TCCAGATCGTCGAGCTTGAGAAGGTGTATCCGAACGGAAAGCGGGCTGTTAAGAGACTCTCGTTTGGACTGCAACAAGGAGAATGTTACGGCTTCTTAGG
TGTCAATGGCGCCGGGAAAACGACAACGATGAAAGTTTTGACAGGCGACTTGTTACCAACGTCGGGTACTGCGACGATAAACGGCTTTGATATCTGCAAG
GAACGCAGCAAAGCTCGTGACTCAATTGGTTACTGTCCCCAGTTTGACGCGTTGATTGATCTACTAACTGTTCGTGAACATCTTGAGCTTTTTGGTCGGT
TTAAAGGCTTCGATACCACCTACAGACTTAAGAAGGAAGTGGATCGCTTACTCAACAAGCTTCAGATTCAGAGATTCGCTGATAAACTTGCAGGTAGTTT
GAGTGGCGGTAACAAACGCAAGTTATCGCTAGCGATCGCGATGATAGGCGAGCCAAGTGTTCTTGTGCTGGATGAGCCGTCGACTGGGGTTGATCCGTTC
TCACGTCGATTACTCTGGAACGTCATCTTGGAGGCCTCGGTAAAATCTCGAAAGTCCACTGTAATGTTAACGACACACTCCATGGAGGAATGCGAAGCTC
TGTGTAGCAAGGCTGGCATTATGGTGGACGGGGGGTCTACGATGCTTTTGGCAGCATTTCCACATCTGAAAAATCGATTTGGAGACGGGTTCTTGCTAGA
ATGCAAGCTGGAGTTGCCTCCCCGACACGCCTTCTCTGACTTGGTGCAGCTAGTTTGCGACCACCTTCAGATTCCTTCTACTCAAGGAGATGACGTTCCG
ATCACCGCTCCACAAATTGTCGGGGTTTGCTCTGCACTTGGTAATGCAACGTTTGCAGACCTTGCGGTTGCAAGTTTCTCAACACAGTTAAACCGCGGAA
ATTGTGCTGTCAATGTTGCTTCCTTTTGCAATTGGTGGTTGTTGGAGGATAGCGTGCAGCGTTTGGATACATTCCTTCATACTCAGTTTACGAACGTCGC
TCTCATCGAGCGCCAGGCCGATTTCTGTAGGTACAAAGTGACTGCACCGAAAGGTGAGGCCAGCGATAAGCAGATCGTCACCGTACTGTCGCGCATGTTT
GAGGTCGTGGAAGCCGCGAAAGGCCGGCTAGGTATTAAGGAGTACAGCCTGTCCCAGACGACATTGGAACAGATTTTTAACTCCTTCGCTGGCCGTCACG