Description :
From Genome Similarity Track
Location :
Scaffold_4:135553- 140740
Transcript NameFunction/comments
Phyca_LT1534525500protein kinase, putative
Phyca_LT153478752TonB receptor activity

Sequence
5187 bases(100 bases per row)
cctctcgctcgattttaaatccattttattggccgaaaatcgccacagtagtcttcggagctgctggccgaacatggcttcgtcatgttgcgaggcggct
ttcgccgcggaacgagcgcgcactcgtccacgggagcctacacagcattgccattcacacgcctcccttctattcggaagtgagccgctataggtggctg
caggcgtgtacagtatcccccccacgtctgatacagctgagaatccccgctgctctttgacaccaacctgtacgacgtccgtcttaaacctctattcccc
tttcattaaagctaatccttctctatctccccctccctaattgcagggtgtatctgtctatgcaagcgtggttgactttggcgtttggcgtctcggagct
gctaagcggagaagtcttcgctgccagctcctcaggttccagcgagacgacgacaaccagcggcactctgaacacgttaactactagctgcaatggtggt
tgcagcagcaacagcgcctgcgtggtggtgggccaatcttcagccaactccattaactgtgtaaacgacaccaactgcgttacgctgtcatccggacagt
cggcgttgtgcctcgacgccttcagctcgtcagccacagaatgggtcttccaacccgcagaaagcaacgatacagcaggcaccggcccttttgaacgcgt
tggactgctgcagctggacgaccaggttacaggcttgacattcaggttggcagagcagggagaggaaccgctttccggaaagttggaactcgcgtcaatg
aacattcaaccggacaccacactggacaaagtgacgttccagaacttgactctctctggattggacagcgctctgccgcttaacagcgtcaaaagaatgt
acgctactataacgttgttcaaaacccaaggatgatgtggaatctgacaggacaatgtgttatttattgatgaacagatatttcaataactgctcactaa
aagagatccccaccgccgctgttgcaggcgactccgtcaccgtcatgtacgatcccccagcgtgtaatctctgtggattttgtctgacctaaagttgttt
aattttctacacgcactgtagtgacttagctggcaatgccatcgccaatgtggactcaaacttccaagacgaagcctttaccaatctcactttgctgtac
gtgcctttagcaccttaccgctttcttttgaaatcgagctgactgaatttgttttgtttcatttttagtgatttatcgtcaaatgctttgacagatttta
atcttgtgccggacaacttccctgccatcacgaccttgtaagcattcactttatgcaatgtttctgtgaggggtttaactaactgtttaatcaatgtgcg
tgaatgtagatacctgagcggcaactcattgaaaacggtccctgatgtgatctttaacctttcgaccctacagtacctgacgcttgtcgacaatccgatc
aatgcatcggatctgacaacgcaacagttgacgttcctcgctaaccttgccatattcacgatcgatggaactaccaacaccagcgcgtgtccgactgctg
cagttcagaacaagctgaatgaatcgtttacattctgtgtgggcaacgacgacattgacacctcaaactccactgttacagagcagccagcaacgaccgt
gccaacaacaacggagggagattccacatcctcttcaacaaacaagacatggatcatcctcggcgcgtgtttgggaggtgttgtgctgttggtgctcgtt
ggtctcatctggtggtgttgtcgtcggcgcagaaatgagcaacccaagttgatgaacagtgctattccgtcgatttcaattggcatgggagatttttccg
atcacccgtacatggagctgggagttccccgctctaatgcgtcaagccagacaacgtcagatttcgagttgctggcgtctgtggcagatggctacatcgg
actcacacggttgtcgtatgacgatgtgttcctgcataagatgctgcgtgttagcagccgttcggagctctggttgggcgagtacaagcatgaggctgta
ctcgttaagaagatcaagagtaacacggcatcaaaggcgctactacgtgactttgtgacggagattgagctgatgttcgagcttaaacatcctcgcattg
ctgcgttccgaggggctatgtgggatgcagatggcacggagctgtgcgctgtagtcgagtacgttgaaaaaggtgcgcttcgagactgcacagtgaacaa
cgcgatggagctatcagtaccaaagcagcacgccattgctcggcaaatctcagaggcaatggcgttcctgcacaagcagaacatcatccacgggcggttg
aatgcgtttaatatcctactggacaaggattactctgccaagttgagtcttttcagcatcttccactacgtcaagctgtcacctttggacaatgaatgca
agatctttgtggctcctgagattctgcgcggcgagcagccatcggagcggtcggatgtctacgcgttcggcgtggttcttgtcgaaatcgacaccggtga
gactccagtcatgaacgcaaggaaattaacgatggaaagatcaggtcgtgacgagctttcaccgactgcaaagaagaccgggttccgcttaagccgtctc
tgctccggtgtcatgaaggatacgattgctgcatgtttggaaccggatccaactcggcgaccgacaatggctcaggtggcggtggcttttaagaatggcg
ccatgaagctgtaagctcttgcttggttttcatggagaattcattgcatctattttattttcgacgggaatctttgctacctattcaatctaccagcata
attatgtaaagaaaatagcttgatccttgtaattagcacaacgctgactcatgctgacaaatggacgatggacatgatgaaaaactacggtgtcggtaat
acttgaagtatatgaatgatatatgtttcttgaaaacctgccaaatggacgatggtatgaatgatatacatgtagaagtatgtttcttgcaaacctgcca
tgaagcttcggacacttagtttgtatcaccaaagaaatcaccggtccggaaggccgaatttcgattaaaatttcgtgagtttcgctgctagacctctcgg
tggtaagttgcctcgtcttttcgatgattgccataaagtgatataaagtgataacccacggtagcaaagacgaaagtgcagcaaattgcaagaaaaaatt
ggattgcccttttctacaagctcgaagtgcgtcaaaactatcatgacaataaatattcaacgcgcttccctattcgacgtcaacgatcccaattctatga
gcacgctcgcaaaacgagcgggggccagtatcatcgtttggcaggcttctgcacagccccaggcttggcagcttgatgcagggagcacacgttaccgttg
cgctcgtacgcgggtttgcggcatccttccacgacgcatcgtttgcctggttcataacaattgattgataacaagggcaagagaagaatgtccagcacgt
aagtatacacgcagcctaacaggtaatctgcatagctgaaaaataaacaaaacaagcagctcacctcctccgtgagcccagcaaagaccgtgcgaaactg
ccgttttggtgcagttttcctcgctgcatttgcgacctaaatcataaaaatcccgtaagaaaacgtttacaagtggggaatcgcgctcatgtcccgtacc
tccgccatgagaccagcaaactcctcgagactttgctcggttctcacaccccgcaacagtacacttagtcgagcccccttgaaaatgtgacgcaacgttg
tcagtgcaaatcatgaagccacctttttcggcaatcgcgctttccttaccgtgcttccagcacacgcctaaatttttagcactgctcgtgcaccctacga
cagcgcagcgtttgccgccctgttgatatcaagttgagtgtttgcacagcgcatgtccaacagttagatccaaagtgcaacacgaaataggatacgcaac
ttacaccgtggccgatacagagtccgcggttcaccacgtaacgagtacagttctcaaacttgcagattcgggacttcttcactgtcgatttcgtcggaac
agcagctggagccggtacattggcggctcgattttccgtcgcggcaacacccgaagcaatcgctagatcagctgcaacacgcaccaagatgaagccagca
aacacgcgatcagtccgtgtcatccacggctgcaaactttgcagtgcaaatccagacattcgtctgcaacgttgcagtaattgtcagcgtaacgtaccga
agcttgcaccagtcgcgtgtgcttggtcttcgtctgcgtttccccctaatataaacgccagcgaactcttgctggacgccgttgcacgtccgactagagc
caccgtagtagcatccgtgttcatgatagccgctaggcgatgtcggtttgccgctagctgcagcaccggcaaagctccagcctgcgcatccgactgggac
tggtcactcgacgcagaccaggctgcattcatgttaacgtcgtcggaattggccgcgttcttcatgcagggcgaaggcttgatagggtcaaagagcagca
tccaccgaggctgagatagggagcaaagagtactcgactgcgagtgtatttatattctagcggacggagcccacggacagaggacaccacaccacactac
acgtgcacgggggcaactgttccgaacggcagccgctttgattgttatctgaataatggagcgggacccacttggagaacagctcaagtcgcgtctggat
ggcgcccagagacaagcccgcgcaccgaggctcgggatgcgttgattgctttgggctgcgtcactgaaggaaccagtggtgaccgtgcagctccttggga
tccgctatacgggcgcgctacggtacgcgtccggcttgacgctacacttggtgtttgtatgggaggtgtcatgacaacggatggcggcgaaaattgacgg
tatttcgaccaatcgctaggaggaacccatttcgagcttcgaaatcccacccatactggatccaagatgttcccgactcgtctcttg