Description :
From Genome Similarity Track
Location :
contig_29:13553- 14755
Transcript NameFunction/comments
g6719.t1hypothetical protein

Sequence
1202 bases(100 bases per row)
GACGAATGCCTGCTGGCACCATGAAGTCCATACCAAGTATCAAATCCTGACCACCAGTGGGTGGTCCAACCCAAACATCGAAGTAATACACCAGCGATCC
CGCGAGCGTGATCTTGATTCTGGTACGTCCTTCCGCCATATAGGGATTCTTGCCAACACCCTCACACTCCAACTCCTGATTGTTATCTATGTAGCACCCA
ACCTTACGAGCAAAGGCGGCATCCAAAATGGACACCTCGGCGCCACTGTCAAACAGCAGAGTGGCTTTTTCGTTGTTGATCTTCCCCACGGCTTTCGCCT
GGCGAAACTTCTTGTCTGGCACGTGATACTTCCAATATCCTCGGATTCTCCATGCAAGAGATCCAAGGCCATCGTCACTTCCGATCGCGAATATTCGTCG
ACTTGGTGGATGCTGGAGATCGCCACGGTACGCTTGTCATGAAGATCACATGTATTGTCAGTCGGCCGAATCAGCTTACTCACCTCTGACTTCGACTGTT
TCTCGACATATGCATAGATGCAGAACTGAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGATCTAGTTTAACATCTTCTCGGCTGCTTGAGGG
AGCATCCCGCCGTGCTTGTTCGGGTTATACCACTGACGGATCAAGTTGTAAAACTCTTCCATCGGGCACTCTCCGGCTCCGTGGATCTCGCCGCAGGCTT
TGCAGGTGAAAAGACAGCGATCGGTCGGATGACCCTTCTTGCCACACTTCTCGCACGTCAATCGTTGCCAACAACCCAAGTCCGTATGCTTGGTCGATCC
GCAGTGGGAACACGGCTTCCTCGGCAACTCTCCTTCCGGTACCCCAGTCGGCTTGTCGTGTCTGCGGCTGTTCGCATCTCGGTTTGGGCGTCGCTGATCT
TGCTCCTGCGTCGATCGCACCCCTTGATCAGCCGTAGCGGCCAGGTGGATCTTGCACAGATCGCTTTCTCCATCTGATCCGCTGACTTCTGGCTCGGAAT
CACTCGAACTCGCTGCTTTTCTGATCGCGCGAACTGCACGAGCATTTGCAGATGGAGCGACACCAGTTGGCGCCTTCGTTTTCGGCTTGATTGATCCATA
TACCGCTTTTCCTTGTCGGGCTTTGGCTCTCTGTCGCGCCCGTAGCGTCTCCTCCAAGGTGTCTGCGTCGGGAACCCTCAGCAGGCTAGTTGGTTAGCCA
AG