Description :
From Genome Similarity Track
Location :
Scaffold_62:135519- 137883
Transcript NameFunction/comments
Sapdi_VS20SDRG_13659hypothetical protein
Sapdi_VS20SDRG_13660hypothetical protein
Sapdi_VS20SDRG_13661hypothetical protein

Sequence
2364 bases(100 bases per row)
GTCTGGCGGTAGTAGCTCTGCGACGGCGGCCGCGTGCTTGGCCTCGATCTGGTCCACGATCGCTTGGATCGTTGACGTCTGCTTCGTCTTGGCGAGCTCG
ACGAGCGAGATGAGGAGGTCAGTGACCTTGGGCTTGCCACCCATGGCCGACACGACGACCGCGATCTTGTCGCTCTCGACACCAGCGACGATGGCCTGGA
CGGCCTTCATGGCCTCGGCGTTCCCGACGGACGTTCCGCCAAACTTGTGTACGACGAAGGAAGGCATGGAGATGGTAGTGGGCGGTCGAGGAAGCTCGAG
GTAACTTGTGGAATGGGCGGGCGGGACAACGAGGCTGGCTGCTTGCGCGATCTTGGCCGGCCGCCACAAGAAGTTCTCGTGGTCGCCAGCTGGAAAGATC
CGTTATCCTGGTGAATGGTCCGGATCGCAACCACTTGACATTTGTATGCTCCACCACCTGGTGCATTCCCTCAGAAAGCAACCGCCAATGTGGGACAGCC
GCACGAATCAGAGACATTCCCTCACTCTGTCAGCAGAGACGAAGCGGATGCGCGTCACAGAACCAGCGCGGAACGTTAATTACACAATACCGTGTGCTCA
TTGGCTCCTGCGACTGGACTTCAGTGGCCGCGTGGTTTTTTGCACCCGGTAGGGGGGCCTACGTTTTGGAAGTGCCACCGTTGAGTCGACGCTGGTGGTG
GCACCACAACGACGATTCTAGAGGCTGCGCGTCACACAATGGGCTACTTCAAGGCCCGGCAACGCTCCTCCTTCCCGCAATAAGAAATGAGAGCATTCAT
CTCGGTGGTGATGAGAATTTCTGGCAATGTAGCAAGAAAGAGCCTTGAAGGGTTGAACCCATATGAGCGCCACCGGTGACACCCACGATGAGTTGACGGT
ACCGGCGAACCGGCGATGGCGCGCCAACCAGCCTTGAAAGCGCGGTGCTGATGTTGAAGTGGGATTTGCAATCGGTCGCCGTCTGTTCCTTATTTCATGG
GTCCCCCCACAGGACTGTTTTGGTAGTCCGCCCCCCACCCCTATGATATTCCGTGCAAGCTGCTTGGCTTCGGCGAGGGTCGAATCAAACGAGCAGCCAC
GATGAGCAGCGAAGTCCCCGTGATGTCGATGACGCCGACCCAGTTCGAGATGGGAGTGCGTCGCCGCTGCCAGCGACCACGATGGTCTAAGACATGTGCT
TGTAGGAGTGCACGAAGCTGCAGCGCGAGTCGCTCAAGTGCATCGAAGGTAGGCAGCCATGGTACCGCCGTGGGCACTCACCTGCTCTCGCACAGAAAAC
TACCGCCAGCGTGACAAGTGCAACGAGTTCTTTGAGCGCTATCGCGAATGCAAGAAGGTTGCAATTCAGCCACCTCGCTGCGACTGACACACTTCTATAG
GGTCGCCACGCAGCCATCATTGCGGCTCGGCGAGCGGGCAAGCTGGACTAGACACGAGTTACAAACTCGCATGGAGGCAGCTGTCTGCGACTGCGGCTGT
CGCGACCCCACAGCGACTTGTATTACATGGACAATGTAGCAATATCATGCATCTTCGCGATTACCGCGCTTGGCTTTGAGTTCGTCCAGAAACGACATCT
TGGGTGGCGTCGGTGCTGCAGTGGGCGCGCTCGGCGGCGCTGGCTCTGCTTTGTTGGCGCGGCGCTTGAGCTCGTCCAGAAAACTGGGACGTGCGCCCTC
TTCGGATGTCGATGGCATTACACTCAGCGGCTTCGTCTTGAGCAGCGGCGATGCACACGGCGAACGCGAGTTGCGCCGGCGCTGAATCTCAGCGAGGTTG
TTGGGCTTGGCGATATCATCCAGCAGCGTAGGCTCGATGATGGAAGGCCGCTTCTTCAGCAGCGACGGTGTCGTGGCCAGGCCCAGCATCTTGAGAAGCG
CGTGAGACTTTGGCTGGGAGGCTGCCTTGGCCGGGACGTTTTCGACCGACTCGGCACTGCTAACCTCGTCGTCGGGCAGCGTTCGAGTGCTTTCGCAGCG
AACAAGGTCCTGCGTCGACTTGCGCGCGCAAAAGTCCGTCTGTAGAAAGTGCAAAACGTTGGGCGACGCCTTGACTGCGCTCACAGTGCGTATCTGACTC
ATGACGTCGTGGACAGCCTTGACGCACGTTTCCTTGGGCGTGCGCTTGGGCACCACTACCTCCTTTGGTACAGTCATCGCCGCCTCCTAGGATATATGCA
ATTCGTTTGCCGTCATGCGGAACGTTCAGTACCTCGGTTTTGGGAAACTCCTTGGACCGCTCAGCAATCGCATTGGTCAGCTCGTGCTTGCGCGCAAGGG
CTTCTTCTTCAGCCGACAGCTTCTTGTGCATGGCGCGTTCCTTGGGCTTGATGTCGGGCGTCGA