Description :
From Genome Similarity Track
Location :
Scaffold_569:13551- 15081
Transcript NameFunction/comments
Phypl_g9473hypothetical protein

Sequence
1530 bases(100 bases per row)
TCCTTCACCACTGGAGTGTATCCGGCAGATACTTctccgcaagctgcagatAGTACGGCAGTTCATCCTCGACGCTGACTTTCTGCACAACGTCCTCTGG
CACACAAGCCACCTTGCCGAGCGAACTAATCCACTCCTTGGTGTCCATGTCCTGAGGTGCACACAGGTCGTCATAATTGTCCTGCTCGTACCACGTCTTG
AAGGACCAGAAACGCACGACGTCCAGAGCCTCTGCAGGAAGAGTGGTCCTATTAAGAGATAGCACGCGGTGCAGATATTCGTCCGGGGTCCACGGCAGCA
TAACATTCTCCAAGCCGCAATGGCGAGCCGCGCTACGGCCACCCTTTTCACCATTGTAGTGGTCCGAGTTCAACTCATTCAGCTCCGGGAACTCGATCGA
GCTGGGAATCGGCTCACCAACAGCCCACGTCGAGTTCTTGACCATCCACTCATGTGCTGAAATACTGCGCAGCACTGCATTATCGTCGTCTGTCCAGCAC
AAGAATATCATCCCTAGTGCACGGAGGAAAactgcaagttgcagccAGTCGGGGTGTCCGTCTTCcttcactgctgcagcagtagccAACATATACTTGG
TCACCCAGCTCTTCTCTTTCTCGGGCTCGCCTGTAAGTTCCATCACGTACTTGCACGCCTCCGGAACGGACATCCGTGCGTGTTGCAAGTCCCCGTATTT
CGTACTTTGGTTCTCCACGAACGCCGTCGTTTGGTATTTCCGCATGATCTTAACGAAAAGTGGGTGTTGGTCGGCCTTATTGCAGACCAAGGACATGATT
TCACCGCCATCCCATGGCACAGGGTGGTCCGAAACCTCGACCCGTTTTTCCAATTGGTCAATGCACAGGTAACTTCCGTGGAAACTACGAAGTGCCACAC
CTCCAGCAATTTCAGCAGCATTCTCCCCGTGGTGCGGCACCACTTGGAACGTCTCCCACGTGGAATTCAACGGCCGATCAGCCAAAATCGTgccatcttc
ttccacaCACAGGAATTTGCCATGGACACTGCGAAGGAAAACTTCACACATTGCACCGAGCAGCGTCTGCCACATGCATCCGTTGCCTTTGGAGCTGACC
TCGATGTCTCCGTCCTCTCCTGCCACCAGGCAAGTGCCGTCTGGCGTCTGCAGGGTCATCATGCAGAACCAAGTGCTTTCTTTGGGTCGAACCGGAAAGA
AAGTGTTTTTCTGGAACACCGACACCATGGGCACTTTGCGGAGGCAATCGTTGCCGTTGTAGAGGAACAGAACGTTGACCTCGGGCATTTCGACAAAGCC
CCACCCGCGATAGAGTCCCACGAGCCGTCCGTGGCGTTTAGAGTCTTCTTCGGCCTCCAAATAGAGTGCATTGACCTGTTTCTCCTCTAACGTGGCCAGG
GTGGCCAGATAGAGCACGCGggccaagcccaagccgcGGAATTCCTTGTTCACCACCACCGACTTGGCATGAGCCGAGCCGCTCTTCTCCAAAGTGAAGA
TGAGCTTCCCAATTGCTCCGCGCTGAGTCG