Description :
From Genome Similarity Track
Location :
Scaffold_715:1355- 2414
Transcript NameFunction/comments
g12675.t1hypothetical protein

Sequence
1059 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCACCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTTAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCTGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGGTCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTG
AGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTACGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGT
TGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCAC
TATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGGCGCACCGTATGGAAAAGTGGCCACAGTTTGGATGACTTCAGGCATGCGTCGATTGT
CTCTGTCGCCGAGCCGCCCTTCGCCACCTGGAGAATTTGCCTCCCTGAAACTCGACCAC