Description :
From Genome Similarity Track
Location :
Scaffold_28:135499- 137133
Transcript NameFunction/comments
Phyke_g1803hypothetical protein

Sequence
1634 bases(100 bases per row)
TACCGCCTCCGTAAGAGCATATCCTGGTGCGCCAAGGTTCCTTATGAGGCAGTTTTTCAGCTCCCGTCGACCAGGAGTTTTCGAACTCCCTGAGTGTACC
TTAAGGTACGTAAGTGTGAACTTGGTCGGGTGCGATTCGGAAAACCTCACCAAGAAGGCACCGTCGCTGCGTTCACGTGCAGAGAGAACTTGTTCCGACT
CCTGTCGCCCCATTTCACCGTGAAACCACGGCACCAGCTCCCTATTCACACAGAAACATGCCACCAACTGCACAAAACTGTCATTGACAACCTCAAAAGC
TATTCAACAAACAAAATACCCAAGCGTCCACCTTGGATAAACACAATTCGAGAGGTCCGAAGCGTGCAATAAAATGACGAAACTACGAAATCACATCACA
AAATCACATTAATGACTAAAATGGAGCAGTAAAATTGTACTAAAATGGTTGTCCCCACATCTTGTTTAGTGACATCGTCATGCTTCCAGGCGCCGGGGGC
CAAGCAGAATTGTGTCACAATGCGTAACTCATCGCGCGAGAGCTCCGAAGACAGCGACTGTGGGTCACTGATACGCAGAAGAGCTGGGAAAAATACGGAG
CGGAAGGAAACCTGCGGCTGGGAGAGTTCCTCCTCCCACCAACGCAGCCCCGAAGCCTCCATGACGGGGTCACGAATGACATGCATAAATTACTCTCCAC
CAATCAGCGAGCTACTACTGTAGTTAACGTAAATTAATTTGAAATTCGCTATGACTACCCCATTTTGCCTGGTGCGATGGCGAGACTTTGTAGTTCCGTT
ACCCGTTGTTGGCGATACGGTTGTGTTGGTTGCAAATGACTCGTTGCTGGACCTGTGACCAATCCTGAAGGTTGTTTCCGAATCCGGGGACTATTAAACC
CTCGAGTAGATGCATGAGGTCTCACCATTGACTGTCGGGGGGTCGTCGACAAATTCGAGGAGTGACTGCTACTAACCGGATTGGTGACGATATATCGTGG
TGACAGCAATGCTTTCAGGTCATCCTTCGGTTGGGTTGCGGTCGTTCCCGTTTCCGACGCCAAAAGTGACGACCCTAATGTGCCGTCGAGCAGTCCAGAT
ATCGAATCGGATTTCGGCTGGTAAACAGTATTTGGCGTCTCGGGGCTGCCGTGCGTCGCTGTCCTTCCGCTAATTGTCAATGGCATTATCGACCCGGATG
TTGAACTTCCGGCGGAATCGGTTATCAGCGATTCGTcgtgctggcgttgctgtacCTTCCTTGGGCTTGTTGGAGGTTGATGGTCATTGTTCGGGCTTAA
TGGCCTTTCCGCCCTTGGTACAGCAGCCATCGATTGTCGAGGCGACGTTGGCGGGCTGTAAAGTATTTGCTGTGTAGAAATAAAggccgctgcagcttgg
gcaGTCAGTGCGTGACTAGTTCGCGGAGATGTCAGCGACGCACCCGAGAGCCGAGGAGTCTGAGGTCGGAGCGTGTTTGGCTCTGGTGTCTCctgaaact
gcagctggGTCGTGTTAATTGAAGGCGTTTTATCATGAGATATCGGCggtttgctgctgacaatTGTTATCAGCGGTGCTGTAaggctgctgttgtccat
gaaAAAATTTGGGGACAGCGTGCTGTCGCGGGTT