Description :
From Genome Similarity Track
Location :
Scaffold_450:13547- 17636
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_450-fgenesh-gene-0.9Transposase
Pytve_DAOMBR484snap_masked-pve_contig_450-abinit-gene-0.363-hydroxyisobutyrate dehydrogenase

Sequence
4089 bases(100 bases per row)
ATTGCGATCACATCGCCTAGACTAGACATTTTCAATATGCTTGAAGCTACTCCCGTCGATGTCGTTCGGCAGACCCGCCGCTTCACTGGCGGACCCCTTG
AACCACTCCAACGCATACTCGCGGTTCTTCTGGAAGCACAGGAAGGCCTCCACCAGCGCCGGGTTGGCAACCAGCGCCGTCTCCTGCATTGGGCCAGCCG
TGCGGAACAGAACGCGGTGCAAGTCACTCAGCACAGTTCGGCCACTCGAAGCAGCAGCCGGGAGCGACAGAACCATCTCGGCGCATGACGCCAGCAGCGG
GAAGCGGAGCTGGTTGGACTTCCACCATATGAGCGGATCGATGTTCCGGTCGGCGACAGGCAAGCTCAAGAATGCGGCGAACTCCTTCTCCCACGTCGCA
ATCATCTCGTTGTCCGACTGAGGAGATGTCTTTGAAGTCCCAGACGGCAAGTGTGACAGCAAGTCATCGTCTTCGTCGTCGGGAAGCTGTCCATTGCTGG
CAGATCCGTTGTTGTCCGAACCCGTCAGATCGGTTTTCAGATCCAGCTCCGTGTACGAACTCGCTGAGATCCGCGCCGATTCGTCCGACAGCGAACCACC
GCCCACCGCCGAAGAGGAGTCATCGTCTGGCGATGCAGTGAACAAACGGCGAATGTACTTCTTTCCCGCCTCGCAGTTCTCTTTGCTGTGCACGTAGCAA
TACTCCCGGTTCTTGTACCGAGGGTCGAGCAGTGTTGCAGCGAAACAGATCGGGGGAAGAGCCAAGAAGTGTTGGCGCAGAAGCTTGGTGACACCGTCGA
AGAACGCCTTCCACGCCGGCGGCTCGAGATTAGGCGGAATGCCGTCCGTCGACGTATTCGCCTGCTTTTCTACGTACGTCACAAGCGCAGCCGCAATCGT
CGAGATGCTCGAGATGCCATGCTTGTTGATCTCCTTGTCGCTGCCTGTCTTCTTGCACTTCTCGCCCTCGAGCGCTTCCGAATAGCGCGTGAATGGCCGC
AGCTTCTTGACCACGAGCTCCAGCCACTCAGCGGTTTGCAAGGGAAGGAACTCGACCAAGCACGTCCGCGAGATATCTTCCAAATCCACCAAGTGCGTGT
GCAGATCGCGGAGAAAGTCATAGTAAGACACCGCGTCGGACGACTGCGCGACCAGAGCATCGTATTGCAAGTCGAAGAGCGGGAATTTGCGCCGGAAAAT
GGTGTTTGCCTCGCCGTTGCTCGTGAACCGCGACACAAACTCGTCAATCTGAAGCAGGAACTCGGGGAAAGCCGCGACAAACATCTTCTTCTCCAGGCTC
TTGCGCAGCAACTGCACCGCCGACGTCAACAGCGAGGTGCTCTTGGCAGAATCAGCCGACGGCACCCGGCCGTCGAAGTTGGACAGCACAAACAGCGAGG
GAAGATCGGTCGCCGACAAGTCATGCTTGTCTTCTGACCCGAGGAACGACAAGTCGTCCTTGACGCAAATGATCACCTTGTCCTTGATTCCGATGCGCTG
TGACAGGGCAATGGTGTGTAAGTCACGACGTTAAACCCAATGCATACTGTGGATTTGCCAGCTCACCTCGAAGTATTGATCCAAGATAACCCGGAGAGTG
TCGATGCTTGCTCCTTCCTCGACAGGCGTGCAGCCAACCACCACGTCATACGCGCGGAAACTGATGCTGAAGTGCACCTTGACCGCGAGGTACTGCGCGA
GCTTCGGCAGCGCCGGGGACGACGGGTGCTTCCACAGCTCGAGCGAAACGCCAACCTAGTTACACGGATAGCCATCTCAGCAGCCACATATCCGATCCAT
CCATACACAGCACTGCACTCACGCTCTTGGTGCGGGACAGCACCATCTTGGTCGTGAGGAACATGCTCTCCTGCAGCATGAGGATGCTCTTGGCGATTGC
GTCTTCGGTCGGCAGCGACAGGCGCTTTTCGCCGAGCAGCTGGCTCATCACGTACTGTAGCCCAGGACGCGTCGTGAAGTTCAGTGGCAGGTTGTCCACG
AGCACCATAAGCGCCAGGTCCTGCGTGAACTGGTCAGGGTTGACTGTCAGCGGCTGCACGCCGTACACGCCGCCAGGGAGCGAGTCGCGCTGCTCCTTGG
CGAGTGGCAGCGGCGGGAAGCCGAACAGCGCGCCGCCATCACGCTTCAGTGCCGACAACAGCGACGGCGAGCCGCCCGCCGCAGCCGCCACAGCCGCCGC
CAAGTGAGACGCGCTGGCGACGCCGGGGAAGTAGTCATTAGCGGCAGAGGCGGCTTGGCCCACGAGCTTCTGGCGCTTGATGTGTCGCTTGCTCTCGCGG
TGCTCCTCGCACACGGCGTTGGCCTGCTGGTGCGCGCCGTCCGTGCGTCCCGCCGTGCGCAGGTGCGAGAGCAGATTCGACGAGTGGTGGCCCTTGATGA
CGCGCTCGCAGAACTTGCACACCGAGTTCCCCGACGCGTCCTTCTCAAAGTACGCCCACACAGCCGAGACGCTGGCTGGGGGCGTCGCCGCAGACGCGGG
GGCCACGGACGCAGGCGGCGTCGACAAGCCCGCTGGCACCACGCCGGCCACCACCGTCAGGTCCTCGGCCGTCGCCTCACCGGTCGAGCCGCGCTTGCCC
ATTGCCCTTGGTGCTGCGCTTGGTGCTGCCTTGACGGTTGCCCTTGATTGGCAAAACCGGTAGCCGCGGTAGCGCGCGCCAAACGTTACCGGTTTGGTCT
GCGGGTCGATGGAGATGTGGAAATCGAAGGGGGAGGAAAGGAACAACGCGTCGCCCACCCGCGTCCCTCCCGAACTGTGTGTAACATTCGTGTGGCACAT
CGATTACAAGGGGTATCTTATATCAAGGTTCTTTTGATCTGCTCGGTTAGGATACACCCGATGCTGAGGATGAGCGAGCAGTGAATGCCGCTGGTGCATC
CATCCGCTTCCCGCGCGACTGGCAAGCGACGTGTTTCACTATCGAACAGGACTCGCTCAACTCAGGTCGCCGGCGTGGAAGTCCTGGTCAGCCATGCGGT
CGACGGTCGCTGCTACAGCTAAGCGGACCGTGAAGAATCGGGTGGCACTTGCGCGGAGCTTCTCAGGTGTGTCCATCCTTACTATCTCTCGGTCGCGCTT
CGTCTCTTTCTTGTACACTGACTCGCGGCTTTTATCTATCAGCAAATGTCCAAGGAGCACCACTGGGCTTCGTCGGTCTCGGCAACATGGGGTTCCCGAT
GGCTCACAACCTTCTGAAGGCCGGGCATCAGATCGTGTGCTTCGACGCCGACGCGCGCCAAGTCGACAAGCTCGCGGCGCTCGGAGCGACACCAGCCAAG
TCGGTCGCCGACCTCGCGTCCCAAGTGCAGACGGTGTTCTCTGTACTTCCCAACGACGAAGTGCTGACGAGCGTCGTCATGGGCGGTAAAGGTTCTGACA
ACCCAGGTCTGCTGGCGAGTCTGGCGCCTGGTGCAATGCACGTGAGCTGCTCGACAATCCACCCTGACACTGCGCGTTCGCTGGATACCAAGCACAGCGA
CAAGCAGGTGGCTTACGTCGCGGCGCCTATCTTCGCACGGCCGGACGGCATGGAGGCCCTGCAGGCGAGCTTTGTCACGTCTGGCACCAATGCCGACGCA
GTGGAGAAGGCCACCAAGCTGCTCCAGTGCACCAGCCAGGGTGTCTACAGCTTTGGCACGGAGGATGCTGGCGCCGCGAACGCTGTCAAGCTTTGCGGCA
ACTTCTTGATCGCGTCGGCAATTGAAGCCATGGCCGAGTCGCTGTCGCTGCTTGAGGCCAATGGCGTGGACCGCGTGCAGGCCATGCAGTTCTACAGCGG
CACGTTCCTCAACTCGCCCATCTACAAGGGCTACGGTCAGCGCGTGTCGGAGCGCGATCATCGTCCGGGAGGCTTCGCACTCGAGCTCGGATACAAGGAT
CAGCGGCTTGCGCACCAGATGGCGTTGCAGGCGAATGTACCCATGCCGTTCCTGTCCACGCTCATCGACCGGTTCCTCAGCGAGCGCGCCAAAGGCCGCA
GCGACCTCGACTGGTCCGCGATTGGCCTCGGCGTGTGCGAGTCTCGCGGCGCCGACGTGTCAGCCGCGATCAAGCGAGCGCGGGGCGAG