Description :
From Genome Similarity Track
Location :
Scaffold_119:13543- 14785
Transcript NameFunction/comments
Hyaar_Emoy2810140PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1242 bases(100 bases per row)
TCATAGTACATCCACATGGTGGTGGATGCTCCAAGATGTTCATCAGATGGACGTCTGGTGAACAAGCGACAGGCATATCGACAATTCGTCGATGCCAGCT
GACTTGTGGCTCGTAACTTCTGAGCCACAGCAGTCCAATGACAACATCAAATTAGTTATCCAAGTCCAATATGATGAAGTCATCATTATCTTGGACTTCC
TTCAGTGTATAGGTAATAACCACTACACGTTTTATCACTGTAACGGATGCTCCTGTCGCGAGGCGCACCGTCATCCTCGTTGGAGGGATCTCGCGCTCGA
TATATTCGAACTCTCTGTTTTCTAGCGATTGGCTCCGTACAAAGTTGTTCGACACCCCACAATCGACTAGGGCTCGAAGCGACATATTTTGTGTCACTTT
GGGTTTCAAGGTAATAAGGGAAACCTCATTACCAGAAGCAGAAACACACAATGACTGAGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTT
GACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCATTTTTTGGCTTTCCGTTATGTTGTTGCGTCTTCGCAACAACGTCGGACCCACG
CCTTGGACCTCGCTTGGCCGCTTGGCGGTTATTGTTCCTGCGGTACGTGATACCGCGTTCGGAGCACTGCAATTCGTATGCATAATGCCCCGTCTTCTGA
CATCTATTGCATTTTTGCAATTTCTTGTAGTTGTTAACACAAGAGATCTCGCTCCCCGCGTGACAGAGGTCCTTGGTTCTGGGCCTCCATTTTCCTGTCG
TCTCGACGGACGATTGGAATTCGAATTTGCGTGAGCCTGTTTAACGCTGAAGTCCTCCTGTTCCGCAATCGTTATTGCCTCTTCCAGGGTGTTGAGTTCC
AACCGGAACAGGTGGGTTTTGACAGGACCATCAGTCAGACTCTGCATGAACAACGTAATCAACGTTTGTTGGTTCAGTGGATCGACTGTTATGCAACTGG
TAAGGTGACGTATGTACTGAATGTACGAGTATACGTCACGTTTACCTCGCTTGATTCGTAGGAGTTCAGAGCGAGCCCTAAATTTGCTCGCGGCGGCTCA
AATGTTTGCCCTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCA
AGTTCGATTGAGCCAATGCGATCTGCATTTCCTCATCGACGA