Description :
From Genome Similarity Track
Location :
Scaffold_15:135420- 138178
Transcript NameFunction/comments
Physo_535053AlNc14C5G668
Physo_552807ribokinase, putative
Physo_354796ribokinase, putative
Physo_535109adenylate cyclase

Sequence
2758 bases(100 bases per row)
CTGGAAGAGCTGCTCCACCAGCGCCGGCTTGAAGGTCGGCGGCGCCATGATTGAGAAGTGTAGCCATGGTGTGGCGAGACACGAAATCATGTGGTACACA
CTACTTGAAGTTGGGAACGAAAACTGAAGCAACATCACGGTACCACGGGTACACTGTACCATGTTAATACAGTAACCCAGACAAACACGTACTGTACCCC
TGTGCAAGCTTGACCTCAACCACAGCTCGCAGGTGGCGTGAGTCAAGCTCGCCATAGTTCAATTTGCCAGCTAGAGACCAAGTCAAGCCAAGTCCAAGCG
CAGGATGACGCAGAGCCGCAAGCACGTGCTGGTCATCGGCTCCGTGAACGCCGACATCGTCGTGGAGATCAGCCGCCTGCCGGTGCGCGGCGAGACGCTG
TCGGCGTCCAAGCCCGACACGGGCAACTTCTTCCCGGGCGGCAAGGGCAGCAACCAGGCGGCGGCGGCCGGCAAGATCATCGGCGCCGACCACCCGACGC
TGTCGGCCAGGTTCGCCGGCCAGTTCGGCAACGACACGCACGGCGACGCGCTCCAGAAGGCGCTGCAGGGCGCCGGCGTGGACACGGCGCTGGCCGGCCA
CCCGGCCTGCCCCTCGGGCCAGGCCTTCGTATTCGTGTACCCGGACGGCGACAACTCGATCGTGATCGTGGGCGGCGCCAACCGCGCGTGGCCCGACGAA
CTGCCGGCCGCGCTCACGGACGCCATCAAGTCGGCGGCCATCGTGCTGCTGCAGTGCGAGATCCCCGAGCGCATCAATGCGCTGGTGGCCAAGACGGCCG
CGGAGACCAACGTGCCGGTCATGTGGGACACGGGAGGCGACGACACCCCGATCCCCGCCGACCTGCTGCCGCTGCTGACGTTCGTGTGCCCCAACGAGAC
GGAGCTGGCGCGCCTTACCAAGCGCGAGGTGAAGAGCACTGACGACGCCGTGGCCGCCGCCAGGTTCCTGCAGGAGCAGGGTGCCAAGAACGTGCTGGTG
ACGCTGGGATCGGACGGATCCGTGTTCGTCCCGGCCGACGGCTCGGAGCTGGTGCACCAGAAGTGCTTCAAGGTAGACAAGGTGGTCGACACCACGGGCG
CGGGAGACTGCTACCGTGGCGCGTTCGCCGTTGCGTACGCCGAGGGCCGCGAGGTGCTGGACTGCATGGCTCGCGCCGCTGCGGCTAGTGCACTCTGCGT
GCAGCGTGCTGGTGCGTTGCCCAGTCTGCCGTTGGGCGACGAGGTCGTGGCGTTCCTTAAGGAGAACGGCCTGTAGGCGAGAGGGCTAGAAGGAGGTATC
CGTATGATGTATGAACTGTGTTGAATATATGCGCGCACGTACAGCGACTTTTTCAATTCATGATGACTCACACATTGCTGTATGTACTTGTACTTGCAGT
TCAATCATCTAAGCAGCTTTCCGTTCTGCTGCAACCAAGTAGAAATGCGTGGATTGCGGTCAGTCCGAGGTATTTTCACGCTCCTTTTGTTTGCATTGAA
GTCAAGCCCCACGCAAGCTCGTGCGGACCCTGATGCGTGACAGCATCATTGAACTTCAATTGAGTTGCTGCTGAGAGCCCTCCTTGAAGCGAAGCATATT
CACCAGCCTTGACCCTTTTCATTCCAAGTTTGTCGAGCAATAGCTCACTGCACCTCACTCTCGACACTCGGAAGACTCGGCAACAACCGCGCGGCCATGA
CGCAGACTCGCCGACACATTCTCGTCGTCGGCTCTGTAGGAGCTGACATCGTGGTGGAGGTCGACCGTATGCCAGCACGTGGTGAGACGGTATCTGCTAG
CAAGTCGGACACGGGTAACGTTTATCCTGGCGGCAAGGGCGACAACCAAGCTGCTACGATCGCCAAGCTCATCGGAGCGGACCACCCCACGCTGACGGCC
AAGATGGCTTGCCAGTTCGGCAACGACAGCCACGGCAAAATGATCAAGGAGACGCTGCAATCCGTCGGTGTGGACACTTCGCTGTGCACTGAAGCAAAGT
GCTCGTCGGGCCTCGCCTTCGTGTTCGTGTACCCCGACGGTGACAACTCCATCGTCATCGTGAGTGGCGCCAACTCCGCGTGGTCCAACGAGCTCCCCAC
CGGTCTGACCGACGCTATCAAGACCACCGCCTTTGTGCTTGTCCAGTGTGAAATCCCCGTGCGTGTGAACGCTCTGGTCGCGAAGGCTGCAGCGGAGACC
CACGTGCCTGTCATGTGGGACACTGGAGGCGACGACTACCCGATTCCGGCGGATGTCCTTCCACTGCTGACCTTCGTGTGTCCGAACGAAACGGAGCTGG
CGCGGCTAACGACGCGTGAGGTGAACGACATCGACGACGCGATTGAAGCTGCTCGGTTCCTGCAGGAACAGGGTGCGAAGGATGTTCTCGTCACTCTCGG
CGCGGATGGATCGGTGTATGTTCCCGTTGACGGCACGGAAGTTGTGCGCCAAAGAACCTTCAAGGTCGACAACGTGGTGGATACCACTGGAGCAGGAGAC
TGCTACCGTGGTGCCTTTGCTGTTGCGTTCGCTGAAGGCCGCTCGATCCAGGATTGCATGGTCCGAGCCTCTGCTGCGAGTGCTTTGTGTGTCCAGCGTC
CTGGAGCGCTACCGAGTCTGCCATCAGGCGACGAAGTCGTGGACTTCCTGAAGGCTAACGGACTGTAACGCGATGAATGCCCACAAAATGCACAACCTAG
CGTTGATCCGACAATTATTCGTTTACGACCTTGATGGACTCCAATTGAGCTGCTCGGC