Description :
From Genome Similarity Track
Location :
Scaffold_168:13542- 15257
Transcript NameFunction/comments
Albla_Nc14089300conserved hypothetical protein
Albla_Nc14089310DNA topoisomerase putative

Sequence
1715 bases(100 bases per row)
CAAAATGCTCACAACGCGAATTGTGTCCGAATGCGAACAATTCTGAAATCTCCCAGCCGTCCGAAAACTTGTCAGTCAAAGATCGAAATCAGCAAGTCCT
CGGATCGGCAATGGATCAAGCGATCTATCGGGCGTTCAAGCAGGAGGATTTCCATTCAGTATTCAGCTTGATTCAGAATGATATGGATGTGAACTTCCAG
CGAATCGAATCGGATCATTCCACAGCACTAATGGCTGCAGCTCATCATGGACGGGAGGACGCTGCACAAAAATTGTTGTCGCTTGGCGCTAATCCTTGCC
TCACGGATAAAAATGGACATGAAGCATGGGTCTTTGCGGATCGGAAAGGGTATAAATCGCTAACTGCACTGCTCAAAGACAAAGTTGCGGAATGGAAGCG
AAACCATTCTCAACCTTAAATGCAGAGATCTCCGCTGAGACGTATATCTGCGTTCTAAACTTCCCACTTTAGCTGTCTCTATTTCACAAATGCAAGACAC
GATGATCTTTCCTTGTCAGAATTTCCAGTCTGGAGCAGCATCCATGGCCCAGACAAATTTCTCTCGCAATGTCTTGGCAAACACGGCGGAAATTGGCACC
TCATTCTACAACGACACACAGTTATGTAAACAAGGGAAGGATTCACTTTTCGGCTGTAAAATGTACCCTTTTGCACCATGCGACGCTGATACGAGGGTCC
ATATAATTTATTTTGGAAGTCCCCAGCGCGACTTGCTTGTTGTCTGATTTGTCCTGCAGCCGAATCGCAAGGGTATTCATCTTCTTCTTCCAGGCTTCCG
TTCGCTTCTTCACTTGTTCCAAGGACGGTGTCTTGGGAAACAGGTGGTTTTGAGCTTTTTTAGCCAGCAAATCTTTCAAATCCTTTTGGTCTTCTTTCTC
GTCCCCATTCTCATTTGCTGTGCTCTGCTTCAATTGAATTGACATCGACTTTCCGCTTTGGATGAGCACTTGCATTTTTTTCAAATCTTGCAACTGCTCT
TTGAGTTGGTCTAGTTGAGCTGTCATTTTTTCAAGTGTGTTATCAAAAGACTTTGGAACCGTTCGCTGATGGTTACATAAAATGGCGACTTCGCGATTTG
CGTCGTTATACGCCACCACTTTGACGTTAGTCTCCAATTTGCCGTCAGGATCTAAAGCGTAAGGTAGCTCCTTCTCCAGTGTTACAGAAGCGTTGAAGGT
ACGAAATACTTTGGCAGTCAAGCCGGGCATCAATGAGCTCAAATGCTTGTTCAAATCTGAAGTCGCCAATTCGTCAAACACTTGATCATTTTTGCTCTTC
TTGTGGCAAAATAATTTCAGATTCGAGTACACTTGTTTGCCAACCTGACCGTACTGAGCCAAAGTGACTGTGTTGTTGTATGGCATGGAATCTTTACCCA
GAAACGCAAGGGTCAATTCACAATTGTCATCGTTGAATGACATGTGCTCCACGCGAAGACTACAGCAGCCGACAGTGTCGGCCTCGTCTTCTCCCTTTTC
GTTACCCACACGAAGAGCCAAGACGTCAATCACCCACATGGCGGTGGAACGTTGTTGCGTTGAGCGGTCTTTTGCCTTGAGACCGCTCGTGTAATCTTTC
CGTATTCTATCAATATGCTTTTTCAGCTGTCGTGCTTTTTCATACTTTATCATATCCGATTTCCCCTTAAAGCTCGAGCTTGCAGCGAGCCAAACATACT
TAATTCCACCCATAA