Description :
From Genome Similarity Track
Location :
Scaffold_81:135410- 137067
Sequence
1657 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTCAAAGGGAAATGTATTCACAGCGTAAGTTTTGCTA
TGTCTACTATTTTTTCCATCACAGTCCTTGCCTGTAAACTTTGCTATCAGGGGACTCCAGTGTTGAATAGGCCGTCGTTGGTTGAGCAGGCTGGAGGCGC
GGCGCGCCGCTGCTGCTGCGTGCGTGCGAATTAGCCGACGGCTGTATTGGGCTGCAGGCCCAACGGGTATTTGGCAGTCAGCGTGCGATAGCTGGGCTGC
GAGAGGAGCAGCGTAGACGCAGCGACCAAATCGTGGCTCTCGAGCAAGTTGTCGTCGAGGAGACGGAAACGCCACCAAATTGTCGACTTGGCTCTGTGGT
ACTGCGCACGATTTACGTGTCCAAGGGCGTGTGTTCGATCCTACATATTGTCCGAAACGATTTTAGTCTGTTGTGCTTTTAGACATTGAAGTGGGCTATT
TTGTCAGCAAGCCGTGCATCTCTTCTCTTCCTTGTTTTATCCCATCTACTAAAGCGGTGCTATGCATCATATATGCTCAATACATTAACACCGAGCGGGC
ATTTGACAAACATCTCGACCAACAGTAAATATATGTTTGACAAAACAGTGGTGAGCAAAAACCCCAAAAAGAAACCCACAAATCAGTTCGACACTTTCCA
ACACGGGAATCAGAGCGTGTTTCAAGGGCCATGAGGCGCTGTGCGCTCTGTGCCTTTCTTCCGTTCTTTGCCACGTACATATGTATAAGTATACTAGTAC
GTGCCGGCATGACCCAGGGTGCCGGTGGCATCGAAGGCTGCGCACTCGGCCTGTCAAGGAGATGAGGGAAGCCCTGAGGGAGGCCGTAAATTATGGCTTG
CTTCGGTGTCCAGCTGCGCCGATACTTGAAGCCAATCAATTTATTATCCGGATGTAT