Description :
From Genome Similarity Track
Location :
Scaffold_218:1354- 3992
Transcript NameFunction/comments
Phyag_g3601hypothetical protein PHYSODRAFT_510673

Sequence
2638 bases(100 bases per row)
GCTCTTGTCCGTACCCTGGATGTAGATGGCGTCACCACCCCAGACAAGGTGGTGGTTGAGCTCGGTGATGTGGATATTCTGCACAATGATGTTATGGCCG
TTTAGTGTCATGCCCTTGCCCATGATCACACCGCTCTTGCCGATACCACGGATGGTTTTGTTTCCCTTCACAGTCATACGCTTGAGGGCGGCATTATCGT
AGGTCACAGTTACCTCCGTACCATTGTCACACCCACCCGTGTTCGTCATGCCACCGCTCTGCAGAATCACATCCTGGCTCTTGTAGCCGTTGTTCTTGGC
AATGCACTCACGAGTGTACTGAGGGCGACAACCCGGTTCAGTGGTCGTACCTTCTGTGCCGCGGAAGTCGAAGGTCTTgttcagcaccaccaccagcggt
TCGGTCGAGTTGAGGTAGTCGATCAGCTCCTCGTTCGTGGTCGGGTACACGATGGTACCGTTGCCTCCACCCGTGGCGCCGGTGGCAAGACCTTCAGGCG
TGCCGATGGTGAAGGCGCTTGTGCTTTTCGCCACGAGAGCCAATGCAGTGGCCAGAGCGAACTGAATGCGTCCCATACTGAAGATGCGAAGAAGTCTTGA
GGTAGGCGGTTGGAGTGTAGTGCGCAAGGCGAGGAAAAATGGAGAATGACCGTTTGCTAACTTCAGTTGATCGATTCGAGCCCACTGTCGATGGTCTTGG
TCGTACCCACGTTCCCATTTACTGTTAATCTGCAGACGCCTTTAAGTTAATGTCATACATACCTTGAAGAGCTTACACATGTCCAATAACGCGCTGGTGT
CCGTGCTAGCGGCAAAAACATCTTGAGCGCGTCCCATAGGGTATGGTTGCGCAACGACCATCGACACGATTTTAGGCCCCTATGTTGCACCAGAAATCAT
ACGCTGGCGAATTCGTTGAGGTTTGAGTTGTACGCATGACTCCACCTTGCCGTATCGCGTCTCAACGACGACGGTCGAGCTGGAGTTGATATGATGAGTC
CACAAAATATCCGAAGAAGGCCCCAACCGCTGCTCGCTGGAAATTATCCTATGGCCATTCAGCCAGTGGATTAAGGCTTAAATTCGTTGGCGTTTGAACG
GTGACAGGGGCTGAGCCCAAGCTGATAGTTGGGAGGATTTTGTATATAACTACCGTACATGACAACGATTACAAGCGAAAACAAGACACATGTAGCAAGT
GGGACGGTTGGGCAAGGCCATCGTTGGGCTGGCCACCCACGTGTTGATCGTGGCACGCAATAATGCAACGAATAGAATTTGCCTGCATTGGGGGCCTCCA
ACGCCTGTGCAATGCTGAGTGAGTTCCAACTACTGGCGCCTAATCTTCAGATGTGCGCCAGCCGAAACCTCAGATCGCACCTTTTCGATATTAAATTCGA
GAATCTGAAGATATTAATTTGGAGAAACCACATCTGTTTTCACTGATCGAGCTGGCATTCCTCGATGCGAAAGGAACCAGTCGCCGTAtcgctgtacatg
tacctaGTTCGCTGCGGACCCGTTAATTGATGCTGTGACCATCCAACGGCATGCACATGTATTGTGACTCAACACTCGACAGAGGTACTCATGCAATGCG
GATGAGGGACCCGTTCCGCTCTCAGCGGAAACGTCCGATCGCTCCCGTACCATCTCGAATGATGCAGCGTGTCCTGAAATACGCAGCACTCAACGACTCG
CGACAAGGCAACCTCGGCCGTTCTCTTGGTCATTAGTCGAGCACGCCATCAGGGAGGATTAAAGTATCACCCCATCAGCTCGTCATTCGCAGGTACCAAA
CACGTTGGAGTGAAGGTATCACACGTTGCGGTAGCGTAATGCGCCTCAGTAGCGACTAAGATGGATTGCTAGCTCAAGCGCGATGGCCGCTTAAGCTGTT
GAAGGCGGaggttttgctgcttcgttACTTTGAGGAAAAAGTTGAACTGTCATGCGGTCGGTGCCCGTGCATTGATACACTCCTTGTTTCACTCCTTCTG
TATGAACAGCCGACCTTTAATACAGTGCGCCCGCCGAATTGGAAAACAGAGTCCTGTAGACTCGGATGGTGAATACCCACCAGCTGAGGCTTCGTGTTAC
AGTCATGCTGATACATATATGTATAAGGTGAAGCCTACTTTATGAGGAGACGAGGAGAGATCCCATCTCCAACAAAACTAAAATGAGCAACGCAACGAAC
TATGTATGACCAGCAGTATGTTGGGCAGTGTCTAAACTTCGCCGAAGTCTGCATACCGGGAGGAAACGCATGGATATTGCTTTCGCCATCGCTTCATCGA
CCGCTCGCGGACGTGTGTGCGTTCTGGCGTATCATACGGCGAAGCTGGGGGCTTCTTGAATAGTAGGAACTCCCTAGTTTTAATCTCGACTGCGAGTTCA
ACGAAGCGAGTTTCAAGCAACGTCGACCCACACAAAATTAATCAGCCGTTGGATCGGAACCAAATCTAGGATTTGATACGTGAAAACGCCGGTGCCCTTC
AACATATCAAGCGCATGCTTACGACTGCTTTCGACTTTGTCGCCCAAGCGCCGTCACGGACTCAGCGCAAGCGGTCACgcgttctccttctgctcgagcC
CACCAATGCGTTATTAGTCCACGGCCATTCTCAAATTT