Description :
From Genome Similarity Track
Location :
Scaffold_1636:1354- 2680
Transcript NameFunction/comments
Phyta_totarag13394hypothetical protein

Sequence
1326 bases(100 bases per row)
CGAGCCCTTCGGACCACTTTCCACCTGTACCAGTTGGATCCATCGGATCGATAGCACCATCGCCAGGTCCGAACTGCTTGCGTCTCTTGTTTCCGTGACC
ACCAGGGACGCTAGGATTTGGGTTGCGCTgggtagctgcagcaggtcgttTATAGGAGGCAGAGTTTAAGGGAGCTGCTGTAGATAGTGTTGGGCCAGAT
GAACGCTTCGACGAATTGATTTGGCCGTTGATCGTTTTCCCATCTGGCGTCACATTTGCGCTTGAGTTTGACTTGACTGCTGTAGTATTTCCACAGCCTT
TCAGGATGCTGTCAAGCTTTGCTTTCGCTTCAAGAGCTTGTACTGTAGCAATAGCAGTCAAATACATATTGTTAGGATACAATTGCATCGCATATCAGCC
AAGGGGGTACGGAAGAATGCCCTTGACGTTTTCTCACCTAACGACACACTCCGTGCAACCGGTCGTGTCCACGTCGTCTCGTTCGTCTTTCGGTTCCAAT
AGTAGACGTCATCACTCGCTCCACCGGGCACTTCTTCCCATCCACTACATCGAAGCAACACACCACACCTCTGTCAACTTTCAGAGCTCCAAACTACACA
ACGAAAGCAGCACAATGATAACGTACTCGGCCAATTGTCCATCACCAGTCTTGGCAtcagcagcctccaccttACTCGTCTGTACCAACCGCCCGTCATC
ACCAAACACTATGTCCTTGAGCATCCAAAGCAGTTGACACATTTCACAAAATCATCCAAACGTTCGCACCTTTATAGCCGAGCTTCCAGGCCGCTCCCAC
ACCGTCTCGTTGGTCGTCTGTATCACCAGCAAAACCATCCCTCACTCAGATTTTTCAATACACTTTCTACTGCTAAATAGCATAGCTACCCACCTCGTTC
CAATAGTACGCATCGCCCGACGCTGggtccaccacctcctgcCATCCTGGAGGTAGGGCGTTGTGTTCTGTCGTTCTCGATTCCAACCGGTAACTCTCCG
TCATCTGCTCGATCTGGTGCGTCTTTTGCAGCTCCTTCGCCCGCCGCAATGCTACCGCGTGCAGCGTGTTGTCCCTCACTCGAGGGTCGAACTTgtcagc
tgctgaaggcTCTCGAGGTTGCGCACCGAGCACGCGACGCTGAGCCACAGAGGACGTGACATTGGCTGTCTGTTTCAGTCTgatttgctgttgttgggCC
AATTCTCGCTGGCTTGGACCGCTGCCAGTGGTCTGAAGATGATTGAGAGCTTCGGCACGAGCCTTTTGGGCTGCcaactccttcttgagccGCTCAGAGG
CGACGGCCGACTTAGGAGGCATCAGG