Description :
From Genome Similarity Track
Location :
Scaffold_30:135371- 136494
Transcript NameFunction/comments
Hyaar_Emoy2804609hypothetical protein

Sequence
1123 bases(100 bases per row)
TACATCGGGACTAAATATAGAAGATCGTAGCGCGGTCTGTAGCTGTAACAACATGATCAGAGTTGACTAATCAATCGCCCGCGACACCACGGGCAAATGC
ACCAAATTACCGCACTAGTTTACACTACCTAATGCGCAACACTGGGTGAATTTTGTGTTGCATTTGAACAACAATAAAAGGCACTTGTAATTCGAGCATA
TGATGGATCGAAGACTGTCCGAACGATTTGATCCAGGAAGACACAGCAGATCGGTTTAGGACCTTGCAGGCCATATCCACCTCGAATGTACGCTGCTTTG
GTGCAAGTGTGTGCTTACACGCACTTGATGCGTCATATGTAAGTTGTGAGTATGGATGGTACAGCCGTGGGAATGAGCATGCGATTTTGGGATCTACGTC
GGCGCTACTTTAAATGCACGTGATCCGCGAGCACCACCCTCAACGTATTGCAATGCAACGAAATCTATCGGAGTAATTTTATGTATCGAGCCAAACAGGA
TGAAAATGCGGCACAGACATGGGTCCAGTCCGTTTTTAAAATTGATGATACGACTTAAGGCACGAAGCATATCTCTATGCAAGGGTATAGCAAGTGCACT
TCGAATATGCGCGGGGCACTTATAAGATGCACGAGCTGAGAGAATAACGATGTTGCGATATGTCAGAGCCAAATACACGACTCGCCGAGCAACGTCACGC
ATTTGTTTCGACCGACGGAGACATTGCAGCCAAAGGCAGGCCCAATATCCGCAAAATGGCTGCTTAAAATTGGAGAATCGCTTCCAAAAACGTTTCTGTG
TACATGACACATGCCTCGACCACGACCACCAGAGTCAAGTTTATGTATGCCACTACTGTATCAAAATCTTACCTTGGCGGTACAGTTTTCAATAACAGTG
TATGGCGTTTGCTCATCCTTTACCTTAACCAATCCGTATCGTTTGTTCTTGCATTCCGACGAAAGATGTGGCTGGTGCCACAACACCGCTTATTGCTTGA
CTTTCTGTTTCTACAAAGCCTTTCTTGATGAAAAGCGCGCATTGCGAACCTGCAAGTGAGAGTAAAATATCGATGTTAAGTATTGTTATTTGTCGTACGC
GAGTGACTACAAATAAAAATACA