Description :
From Genome Similarity Track
Location :
contig_50:13536- 17588
Transcript NameFunction/comments
g8424.t1hypothetical protein

Sequence
4052 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGTCCCGCCTCACTATTCT
TCGTGAGACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGCAACAACGCACCACAGTTGAGATCCGCTTCGTCGATCCAGC
TGGGCTCCTCATATCCACGCCAGTGTACTAGAATTCACGATAGATCCGTCCATATCTCGTACGTTTGCCGGATCTCAGATCCGTGATCTTCTCGACTTCG
TATTCATCGGATCCAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCACAACCAGCTGAACGAGCGG
GCGATCTGGGAATTCCTTCACCAACTTCAATTTCGAACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACCGCGTACTCAT
GGATTTTCTCTGCCACTCGAAATGGCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGCGAGATCCAGCTTCTATCGGG
TGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCGTATAATAACGCTGGA
TCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGGTACTACCCACCGGGATCGTGGCCTCTAATGTAGATCTAGGATCCCACCCATGTACCAAA
TAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCCAATCCTGTTGATCCAGATCCTGGA
CATGCATCTTGAGTGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCTCTGACGCTGTCCTAGGA
TCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGGCGGAACACACATTCTTCGTA
GGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGTGTTGCCTCTA
TGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGGCTTGGATATTCCCTGGCGACTCGCCTCGGATAGTTGGCCGAC
CTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGATCCGCTGGTAAGTGCG
GCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCGCATCGCGAGATCTCGA
TCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGATCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGCTTCTTCCTGGGCC
AACGTAGCTACATCGCCAGCCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGAGCTCCCTCACCA
ATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAATCGGACCACGGATTCTCGGACTGTGACGGTTAGAA
TCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCCATCTCGCTGAAGGGCAGCTCCGGCGAGGCTGTCAGCGG
AACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAAACCTGGGGCCTT
ACAATCAATTTCCCTCTCACTTGCCGGATCACCAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGGTCGAAACACAACAA
GAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATCTGGTAGTTTCCACAGGATCGCGCTGT
ACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACAGGAGCTTGGATCTGCCG
TCGGGGTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTCCACATCGGACTAGGTGTAATACTGGCAGCCATCGCCCCTAGGATTTCGTCTTCACCTTTG
GTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAACAACCATGCTAACGTCG
AATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACACTTCCTTCTCGACCACATTATA
ATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCGGCGGAAATAGCCCATTCGCTA
GCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGCAAACGACCTATATGCTC
TGACCCATCTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGACGAACTGTGATCCAG
GATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAGTCCTCGATAAATCGG
CTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCTTCGGATTAGCTTCGA
TGCCATCGTCGGACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCATTTATCACACGCTTCG
AGCAGATTCTCCACCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGGATGTCATCGATGTAGGATCTGCGTCCTAACACTGACGGACGACCTGG
ATCTTCCGGTTCTCCAGCCTCAAAGATCTGGAGCAAGTCCTGGCTCGTCAGGGGGGGGATCCGTGTAAACCCATATAACGCATTATCCAGAAGCCGCTGA
TAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGCGCGAGCTCGGTCCGTCA
TCGACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATCAGAGGCATGGGGTAGATCA
TTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTGATGATCACCACGATCGGTGATGCCCACGGCGAT
GTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGCTATCTTCCGCACCCGTTGCACGATCG
GCTTCGCACCTCCTACATCGATATCACATACGACTCCTCGGGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAACAAGTGTCGTTTCCGCCAGATGAT
CTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCGCTCGTCATAGCCGTGATCTCTGGC
AATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGT