Description :
From Genome Similarity Track
Location :
Scaffold_29:1353522- 1357307
Sequence
3785 bases(100 bases per row)
CCCGGCTCCACCGATATGAATTGAGAGATGGCCTTCTCTATTACCGGGTGGATCTAGTGAACCACCACGAATGGTCGTACCCAACGACGAAGATCCGAAG
CTCGACATCCTCGCGGAGGCACACAATGCGCCCTCCTGCGGCCACTTGGACCGTGCGAAGACCTTTCTGTCGGTTTTTCAGGCCTTCTGGTGGACCCACA
AGTGGGTAGCCAGGTACGTGAAGACATGCGAAACATGTCAGCGGGTTAAGCCCACAGGGCACGCTTCGGCTCCGTTACAGAACCTGCCCGTACCGACTGA
CTGATGGAAGTCGATGAGTCTTGACTTTATCTTTGGCCTTCCCGCCGACGGACACGGCAACATCGGGATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATG
GTATATCTTGCTTCAGTACCCGTTACCGTCACAGGCGAACAGACCACGAGGTTGCTCGCCGAAGATATCTCGGTGTCCCGGAGACGATAGTCTCGGACCG
AGACCCGCGGCCCACGGCCGTGTTCTGGAAAACGCTGTTCCCTTTGCTTGGAGCTCGTCTGCAGATCTCCACTGCGGACCATCCGCAGACAGACGGCCAG
ACGGAGCGCGTCAATCGAGTACTCGAAGACACTTTGCGCAGTGTGCGCGCGGAAGCCCCACGTACGTGGTCGACTCATCTTCCAGTTGTTGCGTTTGCGC
TCAACAATGCGGAGCACACGTCCACAGAGTTCACGCCGTTCAACTTGAATGGCTTCCGTCACCCCAGAGTGCCTCTCACTCCTCGAGGGGACGCTGCATC
CACTGCATTCTGGGGAGGGGGGGGGGGGCTTGGAAAGCTTTTCCCCCCCAGGTCTCATGTATGAGACCGGTTTCGCTACGGAAACAAGTGGGGTCCTTTG
TGGATTATAAACCGAGTGTGATCAGCAGGGCCCGCGATGCCATGGCAGCGGCCCAGGACAGACAGAAGGAGTATTCCGACAAACATGGAAGAGGAAATTT
AACTGTGCTTAAGGTGGATGAGTTAGTGTTATTAGACACGAGAAACCTATCGCTAGACACCGTCAGATCTGTCGGCAGCAACAGGCTGAAGCACCGCTTC
ATTGGACCGTTTGCAGTCCTGGCAAGGCATGGTGTGTCGTACACCATCGACCTGCCTAAGTCAATGACGACGCATTCGACGCTCTACGTTGGACGTTCTA
AGCGGTACCATGATCCGTAGGGGGTTGCTGACTCGCAGACCCACCTTGCCCCAACCTCTCGATGCGATGTCCGGGCACAGACGTCGACGAGAGCGTCGGA
GCAGGCACCCAAGTCTCGGGCTGAACAGCAAGGCTACGGTCGAGACCATACGTCGGAGAGGCCCCGTACGAACGGACCCCAGAGCCATATGCCGAGTACG
TCGGGTACGCACCATACGCGTACGGCTGGGAGTGCGCCGAATGCGGCTCCGGACGTGGCAGCAGAGCCTCGATACGCCGGATCATGCGGAAGGCCTCGTC
AAGATCGGACAAAGAGGCCCGCCGGTCCACCCGCAGATGCAGGCTCACAACCTCACACTTTAACAGATCCAGGCGGTCCGCAAGACGAGCGAGCACGCCC
TGATTCTCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGACCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGATCAACCTCAGGGCCCT
GCGTCGGACCCGCAGAAGAAACAATCGGACGGGAGCGCTCCGGAGGCGCCGACCACTCGTACTCGTACGAGGGCATGCCTGACTGGAACGGAGAAGTTCA
TTATCACGTGGAGCGGATTCTCCAGAAGCAACGGCGTCGCGGTAAGCGACATCTCCTCGTAAAGTGGAGGGGCTATGCCCACTCCGAGAACTCGTGGGAG
CTGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAACGGCGGCAGCTTCATAAGTAGTCCGGGTCTTCTTGCCTTAACG
GGATACGGACGCTGACGACACTCCGTACCTGCGCTCACCGTGAGCGCTAAACCCCGCGCGCTTCAGAATGTCCCTTAACATCATGCGCTTACTGACCAAG
TGGGCGAACCGGACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGAAACTCCGAGGATGAGATTCCACCCAAGC
CCAGAACATGTCCTGACATGAGCTCCAGTTGGGATAGTTCTCGGGAAGAACCCAGGGAGCCCCAGAGAGGGTAGAGACTACCCCGGTTCTTGAGTTTCTT
ACGACAAGTCGTGAAGTCATTTAGAGGGATTCGGTGCGGCGCGAGAAGCACGCACCGGGCCGCCTCCAAGTTGCCAACAAACGACTGCTCCTTCTAGACC
AGGGTACGTTCGTAAACGCCCTTAAAAGTGCGACCACCAACAAGGCCACGAGGAGCTACGAGAATCTCCAGGAAGAGGTCACCCCCAGAGCTCTCCTCGG
GAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACTGCCGGACCCCCACGCGTGCGCTGGGCAGCTTAGAAGTCCTCCTGCTG
CTGGTCGAGGTCGTTAGTGATCTCCTTGGGCTCAGACATAGCACCCTCCTCCTCCTTCTCCTCCTCGTCCTCTTCATCCGAAGAACCGAAGAGGTTCCGA
TAAAAGTACCCAGTCCTCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCGTACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTAGTGGCCTTAGCACTCG
TATGACCCTCGGCTAGCGAGAGATCTTTGAGAGGTTTCTCCTCCTCGTCGTCGCCAGCTTTGAGAGAGCCCTTAGCTATGGTGACAGGACCCTCAGTGGG
CACAGACGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGAGTGCACGACGTCATTGTCGTGCTCGCTGGGCACTGATGTGTACCCTCCCACGGAG
CCCACAGGAGCATTGTGAGTGCTCCCGGACTCGGCCTCGTCCTCACAGGCCGAGCCGAACCCACGTTCAACGAACCGGGTACTCGGTCAGTTGTCTGGAG
AGTCGGAAGGTGACGGACTGCGGCGCTTGCTTGCACGCTTGCTCGCAGCCGCGCCACCAGATGAATCGATCGTCTCCTAGCCACCTTAGTGGCCTCCTGG
AGCGCAGAGCCTTTGCCGCGAGGTTTAGTGCTCTTGGCTTGCCCCTTTTCCGGCAACAGCCTTAAAGAGAGTTTTAGCACCGCTCTTCGCAGCGCATGCT
GAGGGTCGATGTGGAGACCGAGAAGAAGAGCGCTCAGCCGCTGCTCGAGGCTTTAGCTATAAAGTGAGCCTTCGCCGCGTTCTCACAGCCAAGTCGATGT
ATTTCGACTTTGAGAATGAGGGTTTGTGACGTACACTTCCTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGATGTAACGGAGGACGTAGCCCCG
AGGGTAAGCCTGGGGATTGGAAGTGTGACATATCTACACTTTGGAATACCTACCAGGGTCGTCAAAGGCCAACCATTGGGTAAGGACATAGCTTTGCTAA
AGGTGACTTTAAGTTTGTAAATTGAACTCAAGCTTAGCTATAAATACAGTTAGCTTACACTTACCTTAAACTGGTCACTTCGCTCCCTTCGACAAAAGGA
GCCTGTGAACTACGGCTCGCTGAGAGTTTGTATGCTCTCGGAAGCCGACTTCCTCTAGTGCAAAGTGCTGTGTGACCCCGTCACA