Description :
From Genome Similarity Track
Location :
Scaffold_417:13531- 15370
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_417-fgenesh-gene-0.2ATP-dependent RNA helicase DHX8

Sequence
1839 bases(100 bases per row)
ACAATTGATGAAGGCGATTGCAGAGAACCAAGTGCTGGTCGTGATTGGCGAGACCGGTTCGGGCAAGACGACGCAGATGACGCAGTACATGGCCGAGATG
GGGTTGACCTCCAAGGGTATCATTGGATGTACTCAGCCGCGCCGTGTGGCGGCGTCTTCGGTTGCAAAGCGTGTGGCTGAAGAGTTTGGCTGCGAGCTTG
GACAGGAGGTGGGCTACTCGATGCGCTTCGAAGACTGCACGTCGCCCGAGACAGTCATCAAGTACATGACGGAAGGTATGCTGCTTCGCGAGTACCTGGC
CGACAACTCACTGTCCAAGTACAGCGCGCTGATGCTGGACGAAGCGCACGAGCGCACTATCAACACGGATGTGCTCTTTGGTCTCCTCAAGGCGCTGGTG
AAGAAGCGTCGGGATCTGAAGATCATCGTCACGTCAGCCACGCTCGATGCCGAGAAGTTTTCGCGCTACTTTTTCGACTGTCCTATCTTCACGATTCCGG
GTCGGACATTCCCGGTCGAGATTCTGTACACGAAAGAACCGGAGCTGGACTACTTGGACGCAGCGCTGCTCTGCGTGATGCAGATCCATCTATCGGAACC
TGAAGGCGACATCTTGTTGTTCCTGACAGGTCAGGAAGAGATCGACACCGCGTGCGAGGTTCTATACCAGCGCATCAAGGCATTGCAAGAACGTGCTCTA
GCGCCAGAGCTGATCATTCTACCGGTGTACGGTGCGCTGCCGTCGGAGATGCAGTCGCGAATCTTTGAGCCGGCACCGAAGGGCTCTCGCAAGTGCGTCG
TGGCGACCAACATTGCCGAGGCGTCGCTGACGATTGACGGCATCTACTACGTGGTGGACCCTGGGTTCTGCAAACAGAATGCGTTCAACGCCAAGATCGG
CATGGACTCGCTTGTGGTGGTGCCGTGCTCGCAGGCATCGGCGCGGCAGCGCGCTGGTCGTGCCGGGCGGACGGGTCCTGGCAAGTGCTATCGTTTGTAC
ACGGAGAACGCGTACAAGAACGAGATGTTGCCGACCACGGTTCCTGAGATCCAGCGCGCGAACCTCGGTTCTGTCGTGCTGCAGCTCAAGGCGATGGGGA
TCAACGACCTGATGAACTTTGATTTCATGGATCCTCCGCCGCAGCAGGCGTTAGTCACCGCTCTCGAGAACCTGTACGGTCTTGGCGCGCTGGACGACGA
GGGCTTGCTGACGCGACTGGGCAAGAAAATGGCCGAGTTCCCAGTTGAGCCGAAGAACGCCAAAGTGTTGCTCACTTCGGTCGTGCTCGGATGCGCGGAG
GAAGTGCTGACGATCGTGGCAATGCTTTCGGTCGAGTCTGTCTTCTTTCGTCCCAAGGAGAAGCAAGCGCAGGCGGACCAGAAGAAGGCCAAATTTCATC
AGCCTGAGGGAGATCACCTGACGTTGCTGGCCGTGTATGAGGCGTGGAAGAACTCCAAGTTCTCCAACCCGTGGTGCTACGAGAACTTCATCCAGGCTCG
CGCCATCCGCCGAGCGCAAGACGTGCGCAAACAGCTGCTGTCGATTCTGGACCGGTACAAGATGGATGTGGTCTCGTGCGGGAAGAACTTCAACAAGGTG
CGTCGCGCGATCGTCGCGGGTTACTTCGCCAACACGGCCAAGAAGGATCCGCAGGAGGGCTATCGCACCATGGTTGAGGGTCAGCCCGTGTACATCCACC
CTTCGAGCGCGCTGTTCAACAAGAGTCCGGAATGGGTGTTGTACCACGAGCTGCTGCTCACGACGAAGGAGTACATGCGCAGCATCATGACGATCGAGCC
CAAGTGGCTCGTGGAGCTCGCGCCTGCTTTCTTCAAGAA