Description :
From Genome Similarity Track
Location :
Scaffold_158:1353042- 1358248
Transcript NameFunction/comments
Aphin_H310_07961callose synthase, putative

Sequence
5206 bases(100 bases per row)
ATCCAGCCGTGCGTGAACCCACCAAAGAGACCGGTAAACATGCTGATCGTGGCGGCAAACTCCCCGCCCGTCGACAGGGCTTTCGAAAAGCCTTCGTTGT
ACATCATGCGGGTTTGGATCGTGTGCATGAACGGAATCGCCGACAGTACGATGAGCGGCACGAGCAGCATCAGACCCAACAACGAGTCAAAGAGGTAGCC
GAGTTGTTGGACGAGGCCCCACTTGGACAGAGGCAGGCCGACGACGCCGTTGAAAATGATCAGGTACTGAAGCAGGGTGTACAGGCCGGCGTACGTCGAG
ATGAAGAAGCTGAGGTACATTTGGCCATTCTTATCCAAACTTCCCCAGTTCAGAATCATGCCGACAAGGATCACGCCACCGATGGACAACCCAATCACGA
CGACGACGTAAATCATGCCTCGGTACATGCGCGCCTTGTTGCCAAAGCACATGGTCGACACAGATCCCACGATCCACAGCGCCAATGAGACCCCTCCAAC
CGCGGCAGCCACAAGCCAAATGTCTTTGAGCTCAAAATCGCGTGTAAAGATGTAGTACACAACAAGGATATGGCGGAATTCCCGAATCGAGTACGACAGC
CGGGACGTCCACGAGATTGAAGAGTACAGATCGACTTCGGATGTCCACCACGCCAGCCACGAGTCCGAGTCCACATTCAAATCGTCCGACGGGATGGTCG
CGAGCCACGAAAACCAGTTGGTTACGTCCACGCGGGTCTTGCTAAAGTCGAACCCGTCCGTGTTGTACAAAAACGGCGCGAGCATCCAGCACACGACGAG
CAGCCACACAGCAAACGACGCCACACCGTACGACTGCGGGTTTACGGCAAACGATTCCAAGTTTTGAATATACAGCGGTTTGTTTCCGAGGCAGTCGTTG
TCCTTGTTGGCGCAGTAAGCGGCTTCGGCGCCGACGCCAAAGTTGAACGTGCCGTACAATCCATAGATGATGATCAGCGCCATGAGCTCCATCGCTTTGC
GGTAATGGGAAGCTCCGTATTCCTTGAAAAAGCTCACAAACGTGTTGCGAGTGATGGCAAAACCACGACCAGTGCCGCGGTACTTGGAGCCCCCGCGCTG
GATCGCCACGTCGTAAAAATGCGCTTTCGTGCCCGTCTCGAAGATGTAAAACACCGGACCAAGGGTCACGAGGAGCTCAAAAAAGTTGATGGCCGCTTGA
CGTAAGCCGACTTCGACAATCAATGTCGCCATGAGCGGAATCGTCATGAGCATCCCAAACTGAAAAATGAACTGGGTATTCAACACGTCGGCCAAGTTGT
CGAAGTCGGCAGACACTTTGATCACTTCCAGCTCGACTTCAGGGTGGAGAGCCACGTACAGCTTCGAGTACGCGTACACGTACACGCAGACGACCGTCAT
GAAGTTGGCAATGTAAAACCCCATGTGCGAGTAGTACATGGCGTTCAGGCGGAAGAAGTCCATGCCAGTCCCCATGCGATGGGCATCGCGGGTCAGCGAA
CTTTCGGCACTTCCGTTGGCGAGCTTGGCTTCGAACGCGTTGATCTGACTCAGCGAGACATCGCGCCCCTTGCCGCACTGCATGAATTCCAAGTGAACGA
CCTTGCCGCCGCGGAGGGCGCAATTGTACCCGGCAAAAACATCTTCACTCAAATTGATTCCTTTTGACGCTTTCGACACGCCCCCGTTTGTCATGACGTA
CAGCTTGTCAAACACATCAGGATGTCCGTAATGCATACGCGTCTGCAACGGGTTCGCCATCACACGCTGGGTCAAGCTCACAAACACGAGTTCTTGGAGC
GTCATGAACCGCGCGAGAGACGACGCCTTGGCCGTGAAAATGTGCTCCTTCATCCCGATAATCTGCGCCCCCTGGCCCGACGCCAAAAAGTTGGGCATCT
TGAGCGCTTCTTCAAAGTAGTGTTCTTGATTCATGTCGATCGTTTGGATGTACTCGCCGCGGGTGAACGGCAACGCAATATTTTGGTTCTCGGGTTTCCC
TTCGCCAACGATGGGGTGTCCTGGTAATTCGTACCGGTAGACTTCGACAATTTCCTCGCCGTCCGACTTGACGAGGACGCAGTCGTACCGGTCAGGCTCG
CCGTGTTGACCAGGCACAGCCTCCATGAAGCTCACACGCCAGTTCGTGTACTTGCGCATGAGCAAATCAATGTCGGCGGCCCGCGGGTCGTTTTTCTGGC
ATTGCTCCGAGTAAATCTGGCACGACGTAATGTACGAAAACTTCATCCCGACAATGTCGTCCATCTGCTGAATCTTGTCTTCGTGGGAAATCGTTTGGTC
GCTTCCGATCTCGAGCCAACGGAGCATCTTGATTGCATCTTCGTACAACATCATGCCGTGGACAGTACGCGCCAGCGTTTGACCGCGCATGGACGCCCAC
AAACGCACTTGGATCGGGGACGTCGCGAGCGCTTCTTCCATAGTCGTCGCGTTCATGCGCTCCAAAAAGTTCTCCCACTCTTCGGGGTGCAGTGTGATGA
GGTATTTGAGAATGCTCAAGTCGGCGCGGCCAACCTTGTTCTTGGTTGCCTTCTCTTCAACTTTGCGAAACAACGGGTTGAGGTCCACGCGACCATTCAG
TTCCTCCAACGAGTACAGCACGGCTTCGTTGTAGTAAGGCGTCACGACTGAGAACGAATGCATCGACTGGATCGCGTCGACTTTGGCAATCTGCATGTTG
AGCGAATTCAAAAAGAAGCTCATGCGACGCTGAGCTTCCGCGCACCGAGGCATGGCATCCGCAATGTCCAACGTCAGCAAAAAGAAGAGGCGCGTGCAAT
ATGCCATGGTGCTGTCCGCAGACGTCACCGACACGTTCGACATGCGCTCGCCGTCTTCGTCCTGGGGATCGGCAAACAGCGCAGCCATTAAGTGCAGCTG
GTACGTTTTGTCCGGGGACGAACGGATGAATGACGACGACTGGAGCTTCTGCACCACCCAATCGATTGGAAGCACTTGCTCCAGCGTTGAAAACAAGTGC
TGGACTCGTTCGATGACGATTACCACAAGTTCCCGGAGCACGTCGATGCCGCCGTTTTCATCCGATGGCTCAGGCATGTCCAAAAGACAAGCCAAGAGGT
CCACAAAGTTTTCCCGCAGTTGAGGCACATGCGTCAAGTTGGCACGTTGCAACGCTTCTTGGGGTTTCTCGCTCAGGAAATGCAGCACTTCGAGCGCCGA
GTCGTGGTGGCCAAGCAGTTTCTGGAGGATTTGAATGCCAAGTTGGGCCGAATTGAGTGCAACTTCATACAGGCCATCCTTTTCAAGCGTCTTTTGGAGC
TTCGAGTTCCACTTGCCAGCACGGCCAACCACGTCACACGAATTCGACGCCTTCCCAGCGAGCAAGAAGATCGGGTCGTCCACTTGACCAGCCGACGAAA
TTTGATACTGCAGGATTGCCGACTCGCGGTGATCGATCAGATCCGACAGGCGAAAGCTGCTCACGCACTCATTCCACACGACTGAAAAGCGCAGACGGGC
CTGGGTCTCCGGCGAGCTCAGCTTGGCATCGCCGCCAGTCAAAATGCCACGCGCGACACTCGACACGATCTTCTTGTCAAAGAGCGACGGGGCACCCTTC
AAGCGGTCCATGAATTGAATCACACGGGACGAGTGGCCAATCTTCATGCGGATGCCCATGTACCCACTGCACAAAACCAGTCAATCACGTGCAAAAATAG
GATCAACAACCGTACCCGACAATCGATTGAAAAATCGCGAGCCAAATCTACCACGACCGTGAAAACGACTTGCATCAAAGTGCACACGTCACCTGGGTGT
CGTATAAGTACACCAGTATCATTGGCGCCCACAGCGCAATGATAAACGCCATGTTGTGGTAGCCCGCGATGAGTCCCTTTTTCTACACGCCAGCATGAGT
CGACAACGCCCGTCTAGCAAAACCAAAGTACCTGCACAACGTCCAGGTCAAAGAGCTCGATGCTTGGAATGACGAGCGGTCGAATCATGAGCTCAATGTT
GAACAGAAACTTGAGGCCAAAGAGCAGGACCCAAAACACACTGTACTTCACAAAGTCGCCAGCATTTTGGCCCATGTCGCGGCCAATGTACTGATCGCGG
GACCCTTGGAGTACACGCAACCACGACCACTTGGACGTGAGGCTCTTGCACATGTTGAGGATGGCGGCGAGCACAACGGGCAGGGCGTAAATGCCGATGA
TGATACCGCCCGCGTCGAGGAATTTCATGTTCAAAACCGGCACATTCTCAAACGGGGATGTCACGATGCACGAAAACACACCAAGAAACAAGGCGTGCCA
GAACAGGCGGCAGTACAACGACAGCGCGTACGCCTTGTGGCTGAAGATCAGGACGCCGTCGATCCACACCTGCAGGATAACTTTTAGCACCGATAAGCCC
GCGTACGTGATCCCGATGCTGAGCAACGCTTGGTTGCGTAGGTTCGCGATGGCAGGGCTGAATAGTTTGCTGTACATGGCAAAACCCTTTTCGTTCTGCG
GGCGGCTCTTCACGGCCACATACGCGATTGCAATCAGAACGTGAAGCATAACCAGAAGGAAGAAGAAGATGCGGTAGAACGCGAGGAACGGGTTCAGCAA
CGATCGGCGCTCCTTGAACGTTTTAGCCTCGCGATGTTCAAAAGCGCGGGCGACGGTGGTTTCATCGAACCGCAGACACTCTGGCTTCCAGAAGAATTCG
TTTACATCGTCGTAGTTGGTTACGTTCTTGTGGTCGAGGTGCGATGCGGCCTTGGACTTTTTCTTCTGAAGACTTGGGTTCATCTTGGCCACGACGTTGT
ACATGGGCTTGACAACGAAGTTCAGAAACGCGTTGTCGGCAGGGGCAAACTCGGGTTTCTGTTGGGTCGCGTCAAGCTTCTCGAGACGGGACGCCATTTG
GTGGTACAAGAAGCAAAGACATTCGGGCATGAAGCGCAAGTTCCCTGCTTCGCCCCAGATCAAGAAGAAGAGCGCAGCCTGCGTTTCCATGTCGGAGACC
CACTTTGGCTTGATTTGGAGAAAGCGGCACCACTTCGTGTAGTTCAAGAAAACTTGCTTGTGCAGCTGCTTGAGGGCGTCGCCAGACGGGTCCGACGATC
CCTGTTGAGCTAACCGAAACTGCTTGTTCGCGAGGAGCACGGCCATGTGCTCCTTTTGGTTTCGCATGCTGGCCGATTGGAACCCAAGTAGACGCTGGAG
GCGTTC