Description :
From Genome Similarity Track
Location :
Scaffold_838:13529- 15026
Transcript NameFunction/comments
Phypl_g11236conserved hypothetical protein

Sequence
1497 bases(100 bases per row)
GGCTCTCCACACACTTCATCAAGTACTCGGCGGCCATGATCGCGTGTGCGTTCCGCAGCAACAGGTCTTGCTTCCTGGACTCCACTCGCAGCCTGTCGTT
GTCCTGAATCcgcgcgaggagctgctccttctccgtgaAGAACGAGTCCGGGatgctgctcgctctcctGAGCTGAacgacctgctgcttgagccccacc
agctccgcctcgagcatggccttcttctctcTGCGTACAATGTACGTGGGCTTCTTGTCccgcctcttcctcttgggCTCGCCGTCTCCCTCGTGCATCA
CTGCATTCTTCACTGGTCTCCCCACccttttcttcttggggctCGGCAGTTGGGTCCCCTGTCTCTTTCTACCTGGCGCTACAAGCCCCCCCACTGTCGC
GGGGGGCGTCTGGTCCTCGGACGTGCTGCCGTAGCCGTCCCTGTGTCTCTGATGCCGCAACAAGTGCGGCATGTTGGCAGGCGCCTCGTCCCCCcgtctg
cgctgctcgtACTGCGGCTTGCGGCCTGGATTCACGGACTGGATGAGCGACAGCAGGTTgtcggcggctgcggctgcgtccTGCGTCGTCCTAGGGGAGA
TCTGGGTGCGCAGGGCGGCGCGCTGGTCCTGAGGGAAGGACGGGCGCGGGAAGGCAGGCGCGGACGCGAAATGCTGGCGTCCTGAGGCCCCCGGAAGCCG
CACGGGCCGCGAAACGCGGGAGGAGAAGCcctgcgcgtcctgctcggcgtcgtacGAGTCCACGGAGGCCGTCGGGGACGCGCCGGAGCGCTCGTAGAGG
CCCATGGAGGGGGGGCTGGGGATTGCGCTctctgctctgctgcttgattGCGACTGAGAGGTTTATGTCACTCACGCAAAAATGACAGCGCTCGTGGGGG
CTTAAGTAATTGGTTTTGTTAGAGATGATACCTTACTTTGCACATGATATTAAGGGACAGAGCCGGTTTTCAATGAGTTTGTAGGACAGCAAACTTTTCG
GAACACTGAGTTTCTGCCGTGTCTGTTATAGCAAGGTACGCATCATCAACGATGAGCCGTCGATTGCTACAGAGAAAGCAAAAGGGGAAAGGCCTACGGA
CCCCATAATCATGGATTGATAGTAGAACGATTTCGCACCAAACTAATATAGTAATTATCTATTACCACATTCGATTGTAATATCCAAATAATAGCTTCAA
ACGACAAGTCTGATTCATATATTAATAGTAATATATTAGTGAATTATTACTATTGTGCTTTAAACTGACCACCTACAACGTTCAGATTAGGTAGCGTTCT
GTTATCGCTGCCATCTTCCATGAGCTGGATCTCCTTCCTGTTATGCTTCACAAGCACTTACATCTCCGCGCGACGGTTGTCCGTTCGTGTGCGCAAGTTG
CGCAACACAGTAGAGAGAAAACGTACTCCTGAAAAGCGTTGTTCCCCTAACCAAATGCGGGCTAATGTTGCGATGGAGGAGAAACGAGCGCAGCCAA