Description :
From Genome Similarity Track
Location :
Scaffold_212:13527- 16279
Sequence
2752 bases(100 bases per row)
CGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTCACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCA
GGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAA
ATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGA
TGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGG
CTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATA
GTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGA
CAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGAC
TGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCTATTACTTGCACAAGTACAGCGCGAACTACGCCGAGATGGCTCGGCCAT
TATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCT
TGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAA
CGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAAT
TCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGC
AAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTAC
GAGCTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTG
GGAGCGAAGCGTTTAAAGATTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCAC
CGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTA
GGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAAC
GGGCAAAGCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGCGTATGGACTTTGGGTTTGACCTTCCC
AAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGTAAGAGGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTA
CAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAACCGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTC
CCTCTTCAGCGTGCTCGACACTCGTTTGGACATGTCCACAGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCATGAATCGCGTTGTGGAGGATATC
CTCCTAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACA
CTCCGTTCTATGTGAGCGGCTTGGTTAACCCTCGCGTCCCACCGACGCCCCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGC
TGATATCAGCCCTGTTGCGGTTCGCAAGCAAGTCAATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGACTGAAAGCCAA
GATATGCAAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAAGGTTTGAGGTCGGAGACCAAGTTTTATTAAATGCAAAAAACCTACCTACT
CATGCAGTGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTATAATTT
CAACGAAGATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGCCGTA