Description :
From Genome Similarity Track
Location :
Scaffold_88:135254- 137378
Sequence
2124 bases(100 bases per row)
ACACGCTCTACGTGATGCCCAACCCGTTATTGACAACCGAGCCAAGTTTGGAGTCATTAGACCGAGTATTGTGGGCGAGGTGAGCTCAGCTGTGAGCACC
CTGACCACTATAAGTGCTGGGATTTACCATGTGGTGACGGCGAACTCGGCGCTCGGAGACCCAGCCGCAAGAAATGACTTGGGAGCTGTTCCGGTGTGCC
ATGGGACGACCGACTACGCGAGGGACGAGAGTGGACGCGTGGATGTCTGTCCTGCCGTCGCAGCAGACTCAGCGGTATAGCGCTCTAGCGTGACGACTGC
CAATTCCAAGCTGAAGGTATTACTTTCCAGAGATGTTGAAGCTAACAGTGAAGGACTGAGCTGGACGGTGAATACAAGTGACCACAGTGATGAAGGTGAG
GCACGAGCCGAGTATGGAGTCGATGGGTTAAGTTCTGCAGCCGTGGTGAACTCAGCGATGGGTACGCCAAAAGCCTGCATTATTCAGTCGGCGGCGGTGG
ACTCGGCGTCAGCGGATCTATACACTGAGAGTGATTCGGACGTGGCCACAGCATGTCGTCAGGATGTCAGCTACCCCGGATACGCGTTTGGACGCACGGA
AGTTAGTTCTGCCGTCGCAGCCAACTCAGCGGATCGGCACTCCGACGCGACGAAGGACTATGATAGTCGGGAGGTATTACTACATGAAGGAATAACGCCC
AACGACGACCCAGCTACAGCGGACTTAGCGTTGGAGACTATGAAGGCTGAAACCGGTTCGGATGTGGTTAGACAGCATGACGATGATACCATCTACCTCG
GAGACAAGTTTGAACACGCAGAAGTCAGATCGGCCATCGTAGTGAACTCAGCGAATACGGGCCCTGACGTGTACGACAACTATGATTTATCATTGGTATC
ACTGTTGGGAGGTACTGTAACTGAGATCGGAGTAACGAACCCAGCGACGACGGTGTTCGAACCCGGCGGAATTGGATACGGTTTAGAGCAAGCTGAAGAT
GATGAATGCAGCTCGACGAGAGACACAACGGAAACCCTAAGACAACACTACTTGGCTATCGCAGCGACCGAAGACGAGCAAGAGGATGATGTTGACGACA
ATAAAACCGATATCTTTGAGCGGAGTGGGACAGATATGGAGTTGGCGGACTACGCTCACGAGCTGGATTTCCTTCCTGACCTCACTGAAGTTGAGCCTAC
AGAACTCGACTATGGCGCTCCAAACGTCAAGTCAAGTAGTCATACGCCAGCACAGTCGGCTAGGTTGGTGGCAAAGCTGCAAAAACACGAAGGAATAATG
ATTTCAAGTGGTAATGCCCTGCCGCCTCCAGCGTACGGAGCATTGTGCGACATCGACGTTCAAGGACACGCACCTATCAAGCAGAGAGCTCGGCGGATAC
CTCTCCGCCACTTGAGCAAACTGTACGAGTTGTTGAAGGGGTTGCTTCGAGCTGGGTTGATAGCATTCTCGGGCAGCCCTTGGGCTTCACCAGTGGTGAT
AGTGCTGAAGAAAAATGGTGTGGATAATCGGCTATGCATTGACTATAAACTAGTTAATGCGATTACGACGCCCGATGGAATACGCTATGCCACTAGTCGA
TGACCTGCTCACCGAATTGGAGTGTTACCTGTGGTTTTGTTCGCTTGATGCTGCGAGCGGATTCTGGGCAGTCTTGATGACTCGTCGAGCTCGGCAGATC
TCAGCGTTCGTCTGTGCACTTGGACACTTGGAATGGTTACGAATGCCGTTTGGACTGAAGAATGCGCCTATGATTTATCAACGTCTCATCGACAACGCTC
TATGGGGATACGTTCAGCCCAAGGGAGGATGGAAGTTGTTTGCTGAACGAATGTCGATTGCTGAAGCCGAGTCGGGAACTCGGCGAGTCGAGCTCGGCGG
AGTCGGCGATTCCACGCCAGGTCAGCTGACGAAGTTCGAAGCGGACCACCAATCACAAGCTGACTGCGATCCGGTCCGAGACCTGGTCAATGGACCGGAC
GGCGACATGTTTGCTAATGGAGAACCAGACCAGTCTTCTTTGATTCCGGTGTTCAAGCGGAGGTCGTTTGTCGATGATATCTGATTTGGAGGGGAGACGT
TTGACGCCTGCTTGGAGACATTCG