Description :
From Genome Similarity Track
Location :
Scaffold_34:13517- 14786
Transcript NameFunction/comments
Physo_134766hypothetical protein

Sequence
1269 bases(100 bases per row)
CAGCAGTTGCCAGACAGTGGGTCTGCTGCATTTCGCGCTGCCGCACCAGTTGGAGTCGATGAGCGGATCTCCGACGGCGTCGAGCAGTGCTGGAGCCATT
ATGTTGCACTCGGCTACTCGCGGTGTGATGGTGGGTCAGGTGACGACTACGCCGACGTGGTCGTTTGTGGAGGCCGAGGCAGACTTCGAGGTGGACTTTT
ACCCGCCGCGTAAGCCGTCTGCGTGGATCATCAAGGACATGCTGAAGACACTGCAGAAGGACATCATCGCCAACTGGTCCGACTGGGACAACGGCAAGTA
TTACCAGAAGTACGCGTCGCTGTGTCTGATGGCGGCAGACAGCACGATCGTTGGCTCGGACACGACGCTTCTGTCGTATTGTTTGGAGAAGCTGGAGGCT
ATGATCGAGCCGGTGCTGAACAACACGCTGTCACCGCCGCTCATGTACGACACGCTCTACAGCGGTTTGATCTCGAGCTCTATCTTCCAGACGGGCAGCA
TCTACACGGAGTTCGGCAACGGCATTTACAACGACCACCACTACCACTACGGCTACTTCGTGACGGCTTCTGCTATGCTGAAGCACCTGGACCCGAAGTG
GTCGCGCATGCCGGAGCTGGAGAAAATCATCTGGACGATGCTGCGTGATGTGACAAACCCGAGCGCCGAAGACAAATATTTCCCTCGGTTCCGTCACTTT
TCGTGGTATTTGGGCCACTCGTACTCCCACGGAGTGACCTCGATCGAGAACGGCAAGGATGAGGAGAGTACGTCGGAGGATATCAACTTCTACTATGGCA
TGACGTTGTGGGGCAAGGTGACTGGGAACAAGGCGGTGGAGGACCTGGGAAGCCTGATGCTTCGTCTCGATGCCCACGCGATTCGGACGTACTTCTTGCT
CAAGTCGGACAATACGATCCATCCACCTGAGATTGTCCGCAACCGCGTTACGGGTGTCTTCTTTGATAACCGGGTCTGGTACAACACTTGGTTTCTGGAC
AGGGTGTACGCTATCCACGGGATTCAGATGATCCCGGTGTCTCCGATCAACGAGTTGGCCCGCACGTCGACTTTTGTGGAGCAGGAATGGAACGACGTTT
TGTCCAAGGAACGTATTGTGGTCCATGCACTGACCAACTACACGTGGCTCTCGTTGCTTCTTGTGAACGCTGCAACTGTGAACCCGATGGACTCGCTACG
CAAGTTGAAGAATGCAACGATGGACGATGGTCTTTCTCGTTCGTGGGCACTGTATAACGCTGCTACTCG