Description :
From Genome Similarity Track
Location :
Scaffold_105:135166- 137419
Transcript NameFunction/comments
Physo_141918OSJNBa0080E14.12
Physo_141919hypothetical protein

Sequence
2253 bases(100 bases per row)
TTCCCCTTGAAGGGTTTACCTTGGGCGTGAGGTTGATCAGCCGACGAGAACTTCTTGTCGCACTTGGGTTGACGGTCGCGAGCTTCTTCGACGAAGTGAG
TCACCTCGTACTTGACAGCCAAGTCCATAGCGTCGCTCAGGGTCTGGGGGTTCTCGAGCTTGACGTAGCTGCGCGTGCGAGGCTTGAGACCGTTCGCGTA
GCACAGCACTTGGTCGAGTACGCTCATGCCCTCCACTCTGAAGATGAGAGCTGAGTACTCACCGTTCTACGTCTCAATGTCTGCTGCCTGCTTGAGTCGC
TGAAGCTTCTCGCGCAGGACAGCCTGGTAGTTCGATGCATCGAAGTGTTGGAGCACATGCTCACGGAAAACCCCCCACGTGTGCTCCTCGCTTCGAGTCG
TCGACGACCAGTGCAGGAACCAGCCGGATGCAGGCTTCTCCATCGCCGACCCCGCGATTCCTGGTAGTCGGGTGCTTGCGTCTTCGATCGGGATGTTGTT
GATTCGACAGGCGTTCTCGATCTGGAACAGCCATTCGCGGACATCCTCCCCTCGCTTGCCGGTGAACTTCGGCAGGTTGCTCGGCACTCGCGTGCGGTCC
GCCATCGCTTGGTTCAGCCGATCGATCTCGGCGCGTAGTTGGGCGATGGTGGACATGGGCTCCTCGTTGTCAGGTTGCTGGGACCAACAAGTGCTACCAG
TATTTCAAAACGAAGAGGAAGCCAGGCTTGGGGGGATGGCGGGTCTAAACCAAAAGTGACCGCCCCCGCAGTTCGAGTGGATGGAAGCTCCTTTCTAGAA
GCTTCCACAACCACCCTACATCTGCTCTATCCTATTATGTCCTTAACAATGCGAATGATACCTACGGTACTGTTACCTCTCTAATCTGATACAGTCCGTA
TTGAAGTGCAGCCATTTCATAACGTCAAGATGTCCGTTGGTGGCGGCACCGTCCATACCATGAAATATCCGACTATCGGGGGAGTGGTTAGAGCAACCAT
AAGTATGGTTGCTTTTAGCCATTCTGAGACATGTATGGTTGCTTTTAGGGATTTCAAAAATTTCAAGCGTAATTTAAATGTCTAAATTACCATTAAGCCC
TTAGGTTCGCAAATCACGCTAAAGTGCGCGAAGACGAAGACATTGTTCTGGATGAGGAGGATGAGGAAGACAACGGCAACGAAGAGGCGGAGAATTGCTA
CCAAGAGGAGGAAGACGAAGAAGAGGTCGATGATGCCGAGGAGAGCGATAGCGATAGCGATGGAGAGGAGGGTGACGACGATGAACAGGAGGCAGACGAC
GACGGAGAATCCAGCACAGAAGACGAAGCAGAAGCGGGTAAGACTCGTTTGGATTATTGTTGATACTTATTGAGTTGAACTGATAATGTATTGTGTATTT
TTTTAGTTTGTTTACAACGCAGGACACGCAAACAGAGCCCCGAGCCGAGAAAGAAAGCCACAGCACGCATGAAAACACCAGGTATTCTCGTTAAAGTTGC
TTTAAGCAAAAAGGTTGCGCTATCATTAATATTGACATTCACTTTGGAATCGATAGATACCGCTCTGGCCAAATGCAAGCTTTCTGCTGGGGATGAAGCC
CAATCTTTCGCGAAAAAGCGTAAGGCGGAGCTGCAGCTTCACGAGTCTGTCGACGCTGATTCGGTCCCACGTTTATCCAAGCGGAACAAGCAGTACATAC
CGCGGAAGCGATCAAGCAAGCACCTTGACGAGTTGCGGGAGATCAACGAGGAGCGCGAAGAAATTATCAACCCCGTTCCGCCCTTTACCCCAGCGATTAT
CAAGAGTTGGAGCAAGTTCAACGCACACTTGAAAATATACAAGCAGAAGCACCACCTCAAGTTTCGAGTACGAAGCTCGGAGACACGAAATCAGTACAAC
AGGTATGTGTGACCTCTGTTTGATGAGACATTTAAGTTATTATCGAAACCCCCTTTCATATGCAGCAATCATCGGGACCAAATCCCTTCACGTTTTAATT
GGAGTCACAAGGTCCTCCGCTGTACACACGGTGTTTCGCAAGCGTCGCGCTCCAAGGGACATCGCAATAGAAAAGGCAACTATTGCGGGTGTCCTGCACG
CATGACACCAACCGTTCAGCGGACGGAAAATGGCAAATTTCGAATTGTCATAAGAAACGAGGTATCTGCCTTTTCGTGTATTTGTTTGCTTTGTTAGTAT
TTCTCACATGTCGCTGTTGATAATCAGAACTTTACCCACACGCACCCGACCAC