Description :
From Genome Similarity Track
Location :
Scaffold_425:13516- 14627
Sequence
1111 bases(100 bases per row)
CCGCTGTCGACGAGTTCACCGGGGGTGTTGCTGCCGCGACGGAACTCGACGCTCTGGTTGGCGAGCTTGGCCACCCAGTCCCAACCGTACTTCTCCACAT
ACCGAGTGTACACGAACAGAACGGCATCGTCGTCGTGAGGGTACGTCGACGCGATGTGGCCAGCGTACTTGGGGTCCACGATGTCTTCGACCGAAAGCGG
AGGCTCAAGACCAGCCGCCTCGAGGTTGGCCGCGTCGTAAAAGTAGCTGAACGTAAAGAGGACGTGCGACATCCACGCACCGCTCGACGACTTGAAGCGG
TCGTAGATCTTGGAGAAACCCGCAGGCTTGTACTTCAGGAGCTTACCCTCGTCCTCCCAACGCGGGTAGTCCTGCAGCGTCTGCAGCGCGACGATGTCGG
GGACGAGCGTGTCGGTGTCGAGCTGGTTGTCGATGCGCACGTCGTGGTACTTGGAGTAGTCGACGATGAGCGTCAGGTTGAAGTCCGGGTACGCCGCCGC
GAAGGCGTTCTTGACCCAGTCCTGCTGCGTCGGGGTGTCGCCGCCGTGGTAGAGGACGAGGTTGCCACCTTCGGCGATGGCGTCGGCGTACAGCTCTTCG
AGTGACTTGGTCTCCTCCTGGACCTCCTCGGCGTGGACGGTCGAGGCCGCGAGTGCCGCCGCAGCGAGCAGAATAGCAGAGAACTTCATCGTTGAAGCGG
TGGCTGGTTGGAGGCTTGTGCTCGTCGAGGATGAATCAAGAATGACTGAAGCGGTCGCCTCTCGAGTTGCACGCCGAGTGACAACAAAGGAGGCGCGCGC
AGTGTGCAAACACACCAGCTCCGTTAGCTCAAGTGCGAACGGTGGCTCTCGGCATGGATGAGCGGCGCATCAGTGCGCTTTGCAACCAGGAGACTGGCAA
AGATCGCCAATCGGTCGAGCCAACCGGTCGAGCCAATCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTTTCGCTACGCGGTGCGACAGCGA
CAAGCCGTTTCGAGTAGTGGAATTGCACATGTCGAGTGCGTCGCACGAGTGCGATTACGGGAAGCTCCGGTCCGAAAGCCGATTCGGATGGGAAAGCCTC
CAATCACAAAG