Description :
From Genome Similarity Track
Location :
Scaffold_227:13512- 14978
Transcript NameFunction/comments
g15408.t1hypothetical protein
g15409.t1POM62396.1 RNA-directed DNA polymerase [Phytophthora palmivora var. palmivora

Sequence
1466 bases(100 bases per row)
TCGACATCGACATGCAGCAGGGCACAACCTATGGCGAAGTCGGATGCGTCGCATACCACACTGAAGGGACGGTCATCGTCGGGCAAAGCCATAATTGGAG
AGCTCTGCAGGCTGCTTTTGATTGCTTCGAAAGCCTGCTGAGCTTCGTCGTCCCACGACCATTCCGCCTCCTTCTTTAAGAGGTTCGTCAGTGGCCGTGC
CATCTCAGCATAGTTGGCGCTGTACTTGTGTAAGTAGTTGGCGAGGCCAAGCCACTTGCGCAAGTCCTTCTGAGATACTGGCATTGGCCATTGCACGACC
GCGCATATCTTGTCAGGGTCCGCACGGACACCGTCTTTGCCAAAGAAACACCTCAAGAAGGGAATCTCTTCGGCTCCGAAGGTACACTTGTTGATGTTCG
CATACAAGCGATTATCGCGTATGCACATCAATACCTCGCGGAGGTGGTTAACGTGCACTTCGACAGCCGTCTTACCTCCCGAGGAACGACTGTGCACGAT
GATATCATCAAAGTACGTCTGTACGAACTGCCGCATCGGCCGGAAGAGTTGAGTCACCATTCGATTGAACGTGGCTGGTGCATTCGACAGCCCCTGCGGC
ATCACGAGCCATTACCACAGCATCTCGCTGGGTGTGCTCATCGCTGTGAGCGGGACGTCCGGTTCCCGCATCAGCAGCTGATAGTAGCCATCGACCATGT
CGAGTGCACTGAAGATGGTGCAGCCCGCCATGTTGTTCTGTAACACGTCCTTGCGAGGGATTGGCGTGGACGCTGGGATGGTTGCCGCGTTCAACTTGTT
GAACGCATGCACCATACGCCACTTCCAGTTGGGTTTGTGCACGCAAGACGTCGGGGACGAGTGCGGCGACTTTGACTCGCGCACCATTCTTGCGGCATAT
TTCTCCGCGAAGAATGCATCGATTGTTGAAGTAACCAGCCTGAACTTATCGTATTCTCGATAGATGTCACCAGATGTACGGTGCTACGTTTATCATACTT
AAGTCTCATAATGAATCACTTCAGAACTTGCTTTCTCCAGAGAACATCTCCGTGCAGGAGTACTTTGTCACCTTCACACAGGAGCGTTCCGCCATCGATC
ACATCGACTTGCTCCTTCAGTAGTGGCCATTGGCGCGTAGAGCAGTATTAGTGCCCGGCACCAAATCGATCTCGTGTCGCACACCTCGGTCTGGAGGTAA
CACCGACGGTTGGTTATCGCTAACGACATCTGAGAACTCCTTCAAGAGGGGGTAGTACGGATCCGACGGGTTTTTCAAATTGGCCGCGCCATATCGTTTC
TGACTCAAAGAGGACCTCTCGTCCTCCAACACCTCGGGATCCATGACCGAGGAGGTGTTGAGCTCGATCGAGTCGAGTTCGCGGCGGATCAGGACCATCT
CCTCGCGCTCGTCCGCCTTCAGGAGTCGAGAAACTCGACATACGAGAACTCTTCGAGTTCCAATAG