Description :
From Genome Similarity Track
Location :
Scaffold_307:1351- 2909
Transcript NameFunction/comments
Phyra_85769Amino Acid/Auxin Permease (AAAP) Family
Phyra_85770Amino Acid/Auxin Permease (AAAP) Family

Sequence
1558 bases(100 bases per row)
CAGCACGAGATGAACGCGATCGTGACACCAACAACACGGGGCATGCGCGTGGGGTCACTGTGCTGGCGCTGCAGCGCCGGAATCACGATACCGGCTCCGT
ACGCGAGCGCCAGGTTGCCGAAAGCACCAGCCACTTGCTTGAAGGCGAGGTCGGGCTTCGGCACGCTGGGGTGACCGCGCATGCCGTACATCACGACCGA
GACGCCGATAATATCAGCGATGAGCGTGCCCATGCAACCCGCAAAGGCAGCACCAGCTCCTTCCTTGAGAGTTGGCACCAGACACACCGGCAGACACGTG
ACCGCCATGAGGATGATCCACGTCGAGGGGCTGAAAGCCTCCGGGAAGAGGCCGTCGAGCAGAGTGCCACCGAGCACGAGGAAGACGCAAGGGACGAGCA
GGCAGTTGCCCATTTGAGAGATGACGCACAGGTAGCGACCGGTCTTGCCCATGCACCACTCGCCAAGGTCACCGTAGGTTTTGACGGAACGGGGAGCGAG
CAGCATGACGCGGCAGATAGCCACGGAGGAGTACGTGTTGGCGAAGGCCATGAAGGCCATGGCGATGACGGCGATGACGGGGCCGGCACGAGAGAAGTTG
CCGGGCATACCAAGCGTTCCAATGCCGTAAACGCAGCAGAAGAGGTTGAAGGCCGCCTTGGCGTCCTCCATCGTGAAGGCAGGCTTGCGCGCCATGGCGA
GACGGTTGCGGGTGGGTCACTTGAGAGGCCGGCGGAAAATTGGGGACTGAGGTGAAGTGAGGTGGGCGACTACGCCCTCTCGGGCCCTGCTCATCTAGCA
GCTCAACTAGCGAAGTTCTCAGCGATACTCGGACCGGAATGCGCAAGCCCGCTGTAGCCAACGTTAGTACCGGGGGTTAACGGGTTGCAGCAGGGTCCTG
CTGGGCGCAAGAGCGCGGCCGCTATCAGCCTTCCGGGCGCGTCAGATGGCCAAGGACCTATGAGCGCGCGCAAATCCCCGGCACCGCACTTTCTGGTGCT
GCGTTAAACGCTCTCGCACCGGCACTCGCACCACGACACCGGATTTTTGTTCATTCGAGCTCCGTCGTTGCATCAACANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGATGACGTCGAGAACAACCTTCTGAACTATGCCGATGCTGCTACACCCGCTGATGTCGAGCGCTCGGAG
AAGCAGTCGCACGTGTCACGTGCCTCCAAGCGTCGCTCCTTCATCTCCGTTGCCGACAACGAGAACGTGCACCTCGGCGACGACGAGGCCGAGGCTGCCG
AGTACCGCGGCGCGAATGCCATCAAGTACGTGGTTCTGCGGATCATCATGATCGCACTCTTGGTGGTCGCATCGGTGCTCCTGAAGGACCACTTCCACGA
CCTGGCCGATTTCGCGGGTGCGTCGTGTATCACGGTGAACTCGATCCTCTTGCCGATTGTTTTCCTGCTGAAGAAGAGGTGGAACGTGCTACCGATGTGG
GAGAAGATCCCGGCGCTTATCGTGATCGTGGTGTGCTTCTGTCTGGGCTGCTACGTAA