Description :
From Genome Similarity Track
Location :
Scaffold_418:1351- 2734
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_418-snap-gene-0.16Conserved gene of unknown function

Sequence
1383 bases(100 bases per row)
TCCCTCTCTCTCTCGTCTTCCTTCCGTCGTCGTCTTCCTCTTCTTCCTTCGTTCTTGCAACCTGGTCCGTGACTTTCTTGAGCCCGTCTTGAAATGATTC
ACTGGGTGTTGCTTTCTTACTGGTGCTCTGACTGGCGCAAGTGGGCCGAGCAGAGACCCTTGCGACGGCATGGTTTGACGCAGTTTTCCACGGCGCAGCG
CTTGCCACCACCGTGGNNNNNNNNNNCGCGCACATACCGCCACCACGGTCGTTGCGCATGCAGCCGGGCACTTCACAGAGGCGAGAGCCGCCGTGGAGCG
CACAGTAGTCACCGCGCTGGGTGCCCTTGGTGCAGCCGTCAAACATGCAGCGCTTGCCACCACCGTGCGAGCGGCAGTAGCCTCCGCCCTGCGAGCTGCG
CATGCAGCCTTCGACCTGGCACCGCGGTCCACCGCCGTGGGCCTTGCACAGGAAGTTCGACTGCGCGGCCTTCTCACAGCCCTCGAACGAGCAGCGCTTG
CCACCGCCGTGGCGAATGCACAAGTTGCCACCCTGGCTCGACTTGTCACAGCCTTCAATGGCGCAGCGACGGCCACCACCGTGCGAAATGCACAGACCGT
TCGAGCGCGAGCGCTTGTAGCAGCCATCAGCACGGCAGAGGCGGCGGCTCTTGATCTCGGGCATGGCGTTCTTGGCGCGCGCGACCGGAGCACCGGCCAC
CGACGACGGAGGGGTCAACTTGAGCTCTTCGTCGGTGAAATCTTCCTCGAGCGACTCCATGAGCGACTCGATCGGCGTGTTGGCGAGCATGTTGAGGTTC
AGGATACCATCGTCCGACTCAAAGTCCAACGCCTTCTTGTCGGTCTTCTCTTCAGGAGTGTCGACGAGGAAGCTGTAGAGGATCGACATCTCGGTGCCGT
CAAAGCCGTCGTCCAAGTTGATCAGGTCTTCCTTGTCCTTCTCAAGCGCATCGGCGTCATCGGGCATGGAGAAGTCGAGCAGCTCCTCAAGCTCGGCGGT
CTCCAGGTCGTTCGATTCCTGGACCATCGGCATGGCGGCAGGCTTGGTCTCCTCTTCAAACGCCGTCTGCTCGTCGGCAAAGTCGGCCGTGGCGGTCATC
CACGGCATCGACGGCAGGTTGGTGTTCTTGGGGATGAACGACACAAACGGCAGCGCCGGNNNNNNNNNNNNNNNNNNCACCGACATGATGTCGGCACCGC
CGTAGGCCGCCATCATGCCGCTGGCGTCGGCCCACACGGGCAGCCCGGCGGGGGCCTTGCCGGCCTTGGCCAGCGGGAGGGATTTGGCATTATTCCCTGA
GGGTTGGTACCCTGCGAACAGCGCGGCTGCCGCGGGGCCCATGGCCCCCAGAGAATCTCTCGATTCAATGGGTCGGCACATTC